![](https://parts.igem.org/images/partbypart/icon_coding.png)
Part:BBa_K4197021
Ana o 3 expression at the surface of E. coli cells sortable by FACS using mSCARLET-I
Introduction
The mScarlet-I fluorescent reporter has been added on the plasmid allowing to express the gene of cashew nut Ana o 3 (K4197007) on the surface of E. coli. Expression of mScarlet-I is driven by the ihfb800 promoter (see K41970022). This red fluorescence is destined to identify the allergen expressing cells by FACS.
The part expressing the gene of cashew nut Ana o 3 (K4197007) has been completed with the ihfb800-mScarlet construction (K41970022) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.
Construction
The ihfb800-mScarlet construction was amplified by PCR with the high-fidelity Phusion polymerase using IF3_mSCARLET-I F (ttatttgtacagttcatccataccacc) and IF4_mSCARLET-I R (atggtttctaaaggtgaagcagtg) primers. The expected size of the amplicon is 699 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ana o 3 (K4197007) by In-Fusion.
The resulting products were transformed into Stellar cells and positive transformants were selected. The correct sequence was further assessed by sequencing.
Validation
Successful colonies have shown pink coloring even without excitation light indicating the expression of the mScarlet-I, thus validating the mScarlet-I addition to the construction and its correct expression driven by the ihfB promoter (Figure 1).
DAISY PROJECT
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1520
Illegal EcoRI site found at 1734
Illegal XbaI site found at 1505
Illegal XbaI site found at 1651
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1520
Illegal EcoRI site found at 1734
Illegal NheI site found at 1696
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1512
Illegal NotI site found at 2690 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1520
Illegal EcoRI site found at 1734
Illegal BglII site found at 1585
Illegal BamHI site found at 1728
Illegal XhoI site found at 2699 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1520
Illegal EcoRI site found at 1734
Illegal XbaI site found at 1505
Illegal XbaI site found at 1651
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1520
Illegal EcoRI site found at 1734
Illegal XbaI site found at 1505
Illegal XbaI site found at 1651
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1475 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2361
None |