Part:BBa_K314200

Toxin Tse2

A toxic protein originating from Pseudomonas aeruginosa that has been shown to arrest growth in both prokaryotic and eukaryotic cells when expressed intracelluarly. It is a substrate of the Pseudomonas aeruginosa type 6 secretion system. Tse2 has an immunity protein, Tsi2, that, when expressed in conjunction with Tse2 prevents cell death. [http://2010.igem.org/Team:Washington/Gram_Negative Find more information here on our wiki!.]

Reference showing that Tse2 is toxic, Tsi2 is the antitoxin, and that these proteins are transferred into target Gram-negative organisms via a secretion system: "A type VI secretion system of Pseudomonas aeruginosa targets a toxin to bacteria" [http://www.ncbi.nlm.nih.gov/pubmed/20114026]

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal NgoMIV site found at 196
  Illegal NgoMIV site found at 253
  Illegal NgoMIV site found at 378
  
• 1000
  COMPATIBLE WITH RFC[1000]

SZU-China 2019 iGEM team

SZU-China 2019 team this year has characterized this part.

The Tse2 protein was found to be the toxin component of a toxin-immunity system and to arrest the growth of prokaryotic and eukaryotic cells when expressed intracellularly. We wanted to know whether raising the concentration of IPTG could promote the function of Tse2. To characterize this toxin Tse2, we constructed plasmid pET-28a (+) with IPTG inducible promoter and T7 terminator. Then, A growth assay has been done. Here ht115 (DE3) E. coli bacteria transformed with the toxin as well as the ones without toxin were grown for 16 hours to reach the logarithmic growth phase in LB media and then moved to new LB with different concentration of IPTG to grow for more 4 hours. After that, the OD600 was measured. However, the results showed that toxin Tse2 could not work as expected, not to mention the effect of the IPTG concentration. However, the spread plate method results showed that this toxin could function (Fig.1).

Fig.1 Growth of E. coli on Solid Media under different treated

Then, we were looking for a better way to characterize toxin Tse2. SZU-China 2019 iGEM team this year aimed to develop an RNAi-based herbicide for M. micrantha. We constructed a plasmid and transformed it into E. coli ht115 (DE3), which then could transcribe hairpin siRNA.

Hence, we decided to detect the concentration of extracted hairpin siRNA transcribed by to reflect the function of Toxin Tse2. If the concentration of hairpin siRNA is low, it means that Toxin Tse2 works.

We found a G-quadruplex DNA-based, label-free, and ultrasensitive strategy to detect the siRNA. Therefore, we introduced this strategy to test the function of toxin Tse2 and finally verified that Tse2 could work, and this testing method was useful and reliable.

In this characterization, a cDNA strand, which is completely complementary to the target miRNA and partly complementary pairing with G-rich DNA, was designed first. Then this cDNA can be competed off from the cDNA/G-rich DNA duplex to form a cDNA/RNA heteroduplex and release the G-rich oligonucleotides when the target-siRNA was introduced. Recent research progress has demonstrated that G-quadruplex DNA, a specific type of G-rich nucleic acid sequence, can be remarkably recognized by thioflavin T (ThT) with high selectivity, unlike the triplex, duplex or single-stranded forms of DNA. The fluorescence intensity of ThT exhibits a considerable increase upon binding to G-quadruplex DNA, which can be utilized as a signal reporter. The conformation of released G-rich oligonucleotides would change into G-quadruplex DNA with the presence of 2.0 mM K+. Then, the ThT remarkably recognizes and selectively binds to the G-quadruplex DNA, resulting in a significant enhancement in the fluorescence signal (Fig.2). For more information,

please visit SZU-China 2019 iGEM Measurement.

Fig.2 Schematic representation of the direct detection of miRNAs

We designed the cDNA: ATAGTGAGTCGTATTAACGTACCAAC (complementary to some parts of hairpin siRNA, Fig.3) and the G-rich DNA: AATACGACGGGCTATGGGTTTTGGGTTTTGGGAGCTA. Then, we put them together to form a probe and added them into the extracted RNA from E. coli that had been induced by 1mM IPTG to transcribe hairpin siRNA for different hours.

Fig.3 Schematic representation of designed cDNA

We set both the experimental and control group to test whether toxin Tse2 could work to inhibit the growth of E. coli by detecting the hairpin siRNA. The E. coli that could transcribe hairpin siRNA and express toxin Tse2 were experimental groups, while the E. coli that just could transcribe siRNA were the control group. Here ht115 (DE3) E. coli bacteria under the IPTG inducible promoter were grown for several hours in LB media. The results showed a dramatic increase of 495 nm in the fluorescence emission spectrum. We drew the curve of changing hairpin siRNA content according to the fluorescence emission of different samples (Fig.4).

Fig.4 The Fluorescence Emission of different treated samples

The results showed that the toxin Tse2 could work, and this label-free method to test hairpin siRNA had good repeatability and high reliability, comparing the result of the Trieste iGEM team 2012. Moreover, from the results we got, the OD600 value may not work as expected if the cell structure has not been destroyed. Tse2 protein can arrest the growth of prokaryotic cells but cannot influence the cell structure like lysis gene, so we cannot use OD600 to test the function of Tse2 after E. coli has grown for some time.

References

[1] Hood R D, Singh P, Hsu F S, et al. A Type VI Secretion System of Pseudomonas aeruginosa Targets a Toxin to Bacteria[J]. Cell Host & Microbe, 2010, 7(1):0-37.

[2] Robb C, Robb M, Nano F, et al. The Structure of the Toxin and Type Six Secretion System Substrate Tse2 in Complex with Its Immunity Protein[J]. Structure, 2016, 24(2):277-284.

[3] Liu S, Peng P, Wang H, et al. Thioflavin T binds dimeric parallel-stranded GA-containing non-G-quadruplex DNAs: a general approach to lighting up double-stranded scaffolds.[J]. Nucleic Acids Research, 2017.

[4] Yan L, Yan Y, Pei L, et al. A G-quadruplex DNA-based, Label-Free and Ultrasensitive Strategy for microRNA Detection[J]. Scientific Reports, 2014, 4:7400.