Ribosome Binding Sites/Custom/Constitutive/Rackham
Description
The Rackham RBS family are a small collection of constitutive custom Ribosome Binding Sites that have been demonstrated to work in E. coli. By custom, we mean that they are not recognized by E. coli ribosomes, nor by any other know wild-type ribosome. Instead they are recognized by mutant ribosomes with modified anti-Shine-Dalgarno sequences (see here for an explanation of how prokaryotic ribosomes recognize RBSs). The family of RBSs was derived from work published by Oliver Rackham and Jason Chin Rackham. The specific sequences below were based on one of the RBSs selected by Rackham and Chin. Barry Canton designed and characterized the different family members listed below.
Obtaining Rackham RBS parts
The sequences of the Rackham RBS parts can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the RBS parts are relatively short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligo's and annealed. See here for a tutorial on how to construct short parts via oligo annealing.
Via the Registry distribution: The RBS parts are not yet available from the Registry distribution.
Rackham RBS family members
| Identifier | Sequencea | Strengthb |
|---|---|---|
| BBa_B0072 | TCTAGAGCACCACTACTAGATG | 0.24 |
| BBa_B0073 | TCTAGAGTCACACCACTACTAGATG | 1 |
| BBa_B0074 | TCTAGAGTCACACCACCCTACTAGATG | 0.84 |
aThe sequence of individual RBS are shown in black and red. The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence. The start codon of the downstream coding sequence is shown in green. bRelative RBS strengths were measured by Barry Canton as described in the Characterization section below.
Characterization
The RBS parts were characterized using a set of GFP reporters (see BBa_E70201, BBa_E70202, and BBa_E70203). The cellular chassis was BBa_V1009. The RBS were measured in the presence and the absence of the custom ribosomes designed to recognize the RBSs. The data shown on the right shows that the RBSs can initiate translation efficiently and in the absence of custom ribosomes that there is little translation initiated from the RBSs. Further experimental details can be found in the doctoral [http://openwetware.org/wiki/Image:Canton-PhD-BE-2008.pdf thesis] of Barry Canton.
References
<biblio>
- Rackham pmid=16408021
</biblio>
Contributors
