Promoters/Catalog/Yeast/Multiple
This page lists yeast promoters that are Multi-regulated meaning that each promoter is either positively or negatively regulated by multiple transcription factors (other than the sigma factor). For example, a promoter negatively regulated by two repressor proteins forms the basis of a nor gate, the presence of either or both repressors is sufficient to produce a low output from the promoter. These promoters are useful if, for example, you are looking to build logic gates, or if you are looking to build a system where expression of a gene must be dependent on multiple environmental factors.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I766200 | pSte2 | . . . accgttaagaaccatatccaagaatcaaaa | 1000 | 1207 | Not in stock | ||
| BBa_K110016 | A-Cell Promoter STE2 (backwards) | . . . accgttaagaaccatatccaagaatcaaaa | 500 | 2256 | It's complicated | ||
| BBa_K165034 | Zif268-HIV bs + LexA bs + mCYC promoter | . . . cacaaatacacacactaaattaataactag | 457 | 1431 | It's complicated | ||
| BBa_K165041 | Zif268-HIV binding sites + TEF constitutive yeast promoter | . . . atacggtcaacgaactataattaactaaac | 457 | 1163 | It's complicated | ||
| BBa_K165043 | Zif268-HIV binding sites + MET25 constitutive yeast promoter | . . . tagatacaattctattacccccatccatac | 441 | 1163 | It's complicated |