Promoters/Catalog/Prokaryote/Miscellaneous/Multiple
The promoters on this page are prokaryotic promoters that Multi-regulated meaning that each promoter is either positively or negatively regulated by multiple transcription factors (other than the sigma factor). Neagtive prokaryotic promoters other than those from E. coli or B. subtilis are listed here. The equivalent pages for E. coli and B. subtilis are listed here and here. Note that many prokaryotic RNA polymerases recognize similar promoter sequences so many of these promoter sequences will work in other prokaryotes.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K125100 | nir promoter from Synechocystis sp. PCC6803 | . . . cgaaacgggaaccctatattgatctctact | 88 | 2524 | It's complicated |