Promoters/Catalog/Eukaryotic/Positive
All the promoters on this page are eukaryotic promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters. Note that yeast positively regulated promoters have their own page.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I10498 | Oct-4 promoter | . . . taaaaaaaaaaaaaaaaaaaaaaaaaaaaa | 1417 | 1948 | Not in stock | ||
| BBa_J05215 | Regulator for R1-CREBH | . . . ggggcgagggccccgcctccggaggcgggg | 41 | 1188 | Not in stock | ||
| BBa_J05216 | Regulator for R3-ATF6 | . . . gaggggacggctccggccccggggccggag | 41 | 1189 | Not in stock | ||
| BBa_J05217 | Regulator for R2-YAP7 | . . . ggggcgagggctccggccccggggccggag | 41 | 1188 | Not in stock | ||
| BBa_J05218 | Regulator for R4-cMaf | . . . gaggggacggccccgcctccggaggcgggg | 41 | 1189 | Not in stock |