Promoters/Catalog/Eukaryotic/Constitutive
All the promoters on this page are eukaryotic promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcription factors. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself! Note that constitutive yeast promoters have their own page.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I712004 | CMV promoter | . . . agaacccactgcttactggcttatcgaaat | 654 | 10909 | In stock | ||
| BBa_K076017 | Ubc Promoter | . . . ggccgtttttggcttttttgttagacgaag | 1219 | 1353 | Not in stock | ||
| BBa_K1021010 | PgpdA from A. nidulans | . . . tatattcatcttcccatccaagaaccttta | 723 | 1756 | In stock | ||
| BBa_K3046001 | PLEAPglaA_2 | . . . ctttatattatatttgcgcagtcgcctcgc | 683 | 7781 | Not in stock | ||
| BBa_K3046002 | PLEAPsonB_1 | . . . tccataatccgcagcaacaacaaacagcaa | 842 | 7590 | Not in stock | ||
| BBa_K3046003 | PLEAPgpdA_1 | . . . ctaccccgcccccaacagacacatctaaac | 926 | 4619 | Not in stock | ||
| BBa_K3046004 | PLEAPgpdA_2 | . . . ctaccccgccctaaacagacacatccacac | 926 | 4808 | Not in stock | ||
| BBa_K3046005 | PLEAPmstA_1 | . . . tcacgcagtctcctcctcgacatcagtcac | 986 | 4854 | Not in stock | ||
| BBa_K3046006 | PLEAPunk_1 | . . . tcgcattcttgtccacggaacggcaccagt | 933 | 4755 | Not in stock | ||
| BBa_K3046007 | PLEAPgfaA_1 | . . . tcccttaatctcctcttaacattcatcaac | 973 | 4852 | Not in stock | ||
| BBa_K3046008 | PLEAPhfbD_1 | . . . ctcaggcttacaaagaactcaatctatcac | 1014 | 4819 | Not in stock |