Promoters/Catalog/Ecoli/Multiple
(Redirected from Promoters/Catalog/E. coli/Sigma70/Multiple)
This page lists promoters that are Multi-regulated meaning that each promoter is either positively or negatively regulated by multiple transcription factors (other than the sigma factor). For example, a promoter negatively regulated by two repressor proteins forms the basis of a nor gate, the presence of either or both repressors is sufficient to produce a low output from the promoter. These promoters are useful if, for example, you are looking to build logic gates, or if you are looking to build a system where expression of a gene must be dependent on multiple environmental factors.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_I1051 | Lux cassette right promoter | . . . tgttatagtcgaatacctctggcggtgata | 68 | 1735 | In stock | ||
| BBa_I12006 | Modified lamdba Prm promoter (repressed by 434 cI) | . . . attacaaactttcttgtatagatttaacgt | 82 | 5124 | In stock | ||
| BBa_I12036 | Modified lamdba Prm promoter (cooperative repression by 434 cI) | . . . tttcttgtatagatttacaatgtatcttgt | 91 | 2153 | In stock | ||
| BBa_I12040 | Modified lambda P(RM) promoter: -10 region from P(L) and cooperatively repressed by 434 cI | . . . tttcttgtagatacttacaatgtatcttgt | 91 | 2572 | In stock | ||
| BBa_I14015 | P(Las) TetO | . . . ttttggtacactccctatcagtgatagaga | 170 | 1524 | In stock | ||
| BBa_I14016 | P(Las) CIO | . . . ctttttggtacactacctctggcggtgata | 168 | 1523 | In stock | ||
| BBa_I714924 | RecA_DlexO_DLacO1 | . . . actctcggcatggacgagctgtacaagtaa | 862 | 2343 | It's complicated | ||
| BBa_I731004 | FecA promoter | . . . ttctcgttcgactcatagctgaacacaaca | 90 | 814 | Not in stock | ||
| BBa_I732301 | NAND Candidate (U073O26D001O16) | . . . ggaattgtgagcgctcataattggatccgg | 120 | 1336 | Not in stock | ||
| BBa_I732302 | NAND Candidate (U073O27D001O17) | . . . ggaattgtgagctacagtcgtcggatccgg | 120 | 1362 | Not in stock | ||
| BBa_I732303 | NAND Candidate (U073O22D001O46) | . . . ggaattgtgaacgctcataattggatccgg | 120 | 1330 | Not in stock | ||
| BBa_I732304 | NAND Candidate (U073O22D001O47) | . . . ggaattgtgaactacagtcgtcggatccgg | 120 | 1159 | Not in stock | ||
| BBa_I732305 | NAND Candidate (U073O22D059O46) | . . . taaattgtgaacgctcataattggatccgg | 178 | 1193 | Not in stock | ||
| BBa_I732306 | NAND Candidate (U073O11D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 121 | 1323 | Not in stock | ||
| BBa_I732351 | NOR Candidate (U037O11D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 85 | 1333 | Not in stock | ||
| BBa_I732352 | NOR Candidate (U035O44D001O22) | . . . ggaattgtaagcgcttacaattggatccgg | 82 | 1326 | Not in stock | ||
| BBa_I732400 | Promoter Family Member (U097NUL+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 165 | 2515 | Not in stock | ||
| BBa_I732401 | Promoter Family Member (U097O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 185 | 1233 | Not in stock | ||
| BBa_I732402 | Promoter Family Member (U085O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 173 | 1271 | Not in stock | ||
| BBa_I732403 | Promoter Family Member (U073O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 161 | 1271 | Not in stock | ||
| BBa_I732404 | Promoter Family Member (U061O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 149 | 1275 | Not in stock | ||
| BBa_I732405 | Promoter Family Member (U049O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 137 | 1271 | Not in stock | ||
| BBa_I732406 | Promoter Family Member (U037O11+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 125 | 1273 | Not in stock | ||
| BBa_I732407 | Promoter Family Member (U097NUL+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 125 | 1275 | Not in stock | ||
| BBa_I732408 | Promoter Family Member (U097NUL+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 137 | 1275 | Not in stock | ||
| BBa_I732409 | Promoter Family Member (U097NUL+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 149 | 1275 | Not in stock | ||
| BBa_I732410 | Promoter Family Member (U097NUL+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 161 | 1297 | Not in stock | ||
| BBa_I732411 | Promoter Family Member (U097NUL+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 173 | 1297 | Not in stock | ||
| BBa_I732412 | Promoter Family Member (U097NUL+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 185 | 1297 | Not in stock | ||
| BBa_I732413 | Promoter Family Member (U097O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
| BBa_I732414 | Promoter Family Member (U097O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
| BBa_I732415 | Promoter Family Member (U097O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
| BBa_I732416 | Promoter Family Member (U097O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 181 | 1233 | Not in stock | ||
| BBa_I732417 | Promoter Family Member (U097O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 193 | 1233 | Not in stock | ||
| BBa_I732418 | Promoter Family Member (U097O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 205 | 1233 | Not in stock | ||
| BBa_I732419 | Promoter Family Member (U085O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
| BBa_I732420 | Promoter Family Member (U085O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
| BBa_I732421 | Promoter Family Member (U085O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
| BBa_I732422 | Promoter Family Member (U085O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
| BBa_I732423 | Promoter Family Member (U085O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 181 | 1233 | Not in stock | ||
| BBa_I732424 | Promoter Family Member (U085O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 193 | 1233 | Not in stock | ||
| BBa_I732425 | Promoter Family Member (U073O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
| BBa_I732426 | Promoter Family Member (U073O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
| BBa_I732427 | Promoter Family Member (U073O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
| BBa_I732428 | Promoter Family Member (U073O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
| BBa_I732429 | Promoter Family Member (U073O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
| BBa_I732430 | Promoter Family Member (U073O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 181 | 1233 | Not in stock | ||
| BBa_I732431 | Promoter Family Member (U061O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 109 | 1233 | Not in stock | ||
| BBa_I732432 | Promoter Family Member (U061O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
| BBa_I732433 | Promoter Family Member (U061O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
| BBa_I732434 | Promoter Family Member (U061O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
| BBa_I732435 | Promoter Family Member (U061O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
| BBa_I732436 | Promoter Family Member (U061O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 169 | 1233 | Not in stock | ||
| BBa_I732437 | Promoter Family Member (U049O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 97 | 1233 | Not in stock | ||
| BBa_I732438 | Promoter Family Member (U049O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 109 | 1233 | Not in stock | ||
| BBa_I732439 | Promoter Family Member (U049O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
| BBa_I732440 | Promoter Family Member (U049O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
| BBa_I732441 | Promoter Family Member (U049O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
| BBa_I732442 | Promoter Family Member (U049O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 157 | 1233 | Not in stock | ||
| BBa_I732443 | Promoter Family Member (U037O11+D002O22) | . . . gaaattgtaagcgcttacaattggatccgg | 85 | 1233 | Not in stock | ||
| BBa_I732444 | Promoter Family Member (U037O11+D014O22) | . . . taaattgtaagcgcttacaattggatccgg | 97 | 1233 | Not in stock | ||
| BBa_I732445 | Promoter Family Member (U037O11+D026O22) | . . . gtaattgtaagcgcttacaattggatccgg | 109 | 1233 | Not in stock | ||
| BBa_I732446 | Promoter Family Member (U037O11+D038O22) | . . . tcaattgtaagcgcttacaattggatccgg | 121 | 1233 | Not in stock | ||
| BBa_I732447 | Promoter Family Member (U037O11+D050O22) | . . . aaaattgtaagcgcttacaattggatccgg | 133 | 1233 | Not in stock | ||
| BBa_I732448 | Promoter Family Member (U037O11+D062O22) | . . . caaattgtaagcgcttacaattggatccgg | 145 | 1233 | Not in stock | ||
| BBa_I732450 | Promoter Family Member (U073O26+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 161 | 1233 | Not in stock | ||
| BBa_I732451 | Promoter Family Member (U073O27+D062NUL) | . . . gccaaattaaacaggattaacaggatccgg | 161 | 1233 | Not in stock | ||
| BBa_I732452 | Promoter Family Member (U073O26+D062O61) | . . . caaattatgagcgctcacaattggatccgg | 181 | 1233 | It's complicated | ||
| BBa_I739102 | Double Promoter (cI, negative / TetR, negative) | . . . tgatagagattccctatcagtgatagagat | 97 | 3216 | Not in stock | ||
| BBa_I739103 | Double Promoter (lacI, negative / P22 cII, negative) | . . . gttctttaattatttaagtgttctttaatt | 87 | 3188 | Not in stock | ||
| BBa_I739104 | Double Promoter (LuxR/HSL, positive / P22 cII, negative) | . . . gttctttaattatttaagtgttctttaatt | 101 | 3261 | Not in stock | ||
| BBa_I739105 | Double Promoter (LuxR/HSL, positive / cI, negative) | . . . cgtgcgtgttgataacaccgtgcgtgttga | 99 | 3259 | Not in stock | ||
| BBa_I739106 | Double Promoter (TetR, negative / P22 cII, negative) | . . . gtgttctttaatatttaagtgttctttaat | 84 | 3245 | Not in stock | ||
| BBa_I739107 | Double Promoter (cI, negative / LacI, negative) | . . . ggaattgtgagcggataacaatttcacaca | 78 | 3009 | Not in stock | ||
| BBa_I741018 | Right facing promoter (for xylF) controlled by xylR and CRP-cAMP | . . . gttacgtttatcgcggtgattgttacttat | 221 | 3814 | In stock | ||
| BBa_I741019 | Right facing promoter (for xylA) controlled by xylR and CRP-cAMP | . . . gcaaaataaaatggaatgatgaaactgggt | 131 | 1268 | Not in stock | ||
| BBa_I742124 | Reverse complement Lac promoter | . . . aacgcgcggggagaggcggtttgcgtattg | 203 | 1736 | It's complicated | ||
| BBa_I751501 | plux-cI hybrid promoter | . . . gtgttgatgcttttatcaccgccagtggta | 66 | 1222 | Not in stock | ||
| BBa_I751502 | plux-lac hybrid promoter | . . . agtgtgtggaattgtgagcggataacaatt | 74 | 4200 | Not in stock | ||
| BBa_I761011 | CinR, CinL and glucose controlled promotor | . . . acatcttaaaagttttagtatcatattcgt | 295 | 2080 | It's complicated | ||
| BBa_I765007 | Fe and UV promoters | . . . ctgaaagcgcataccgctatggagggggtt | 1128 | 1238 | It's complicated | ||
| BBa_J05209 | Modifed Pr Promoter | . . . tattttacctctggcggtgataatggttgc | 49 | 1265 | In stock | ||
| BBa_J05210 | Modifed Prm+ Promoter | . . . atttataaatagtggtgatagatttaacgt | 82 | 1268 | In stock | ||
| BBa_J58100 | AND-type promoter synergistically activated by cI and CRP | . . . atttataaatagtggtgatagatttaacgt | 106 | 3577 | It's complicated | ||
| BBa_J64712 | LasR/LasI Inducible & RHLR/RHLI repressible Promoter | . . . gaaatctggcagtttttggtacacgaaagc | 157 | 1866 | Not in stock | ||
| BBa_J64800 | RHLR/RHLI Inducible & LasR/LasI repressible Promoter | . . . tgccagttctggcaggtctaaaaagtgttc | 53 | 1631 | Not in stock | ||
| BBa_J64804 | The promoter region (inclusive of regulator binding sites) of the B. subtilis RocDEF operon | . . . cacagaacttgcatttatataaagggaaag | 135 | 2065 | Not in stock | ||
| BBa_J64979 | glnAp2 | . . . agttggcacagatttcgctttatctttttt | 151 | 1249 | Not in stock | ||
| BBa_J64981 | OmpR-P strong binding, regulatory region for Team Challenge03-2007 | . . . agcgctcacaatttaatacgactcactata | 82 | 1868 | Not in stock | ||
| BBa_K091100 | pLac_lux hybrid promoter | . . . ggaattgtgagcggataacaatttcacaca | 74 | 4885 | In stock | ||
| BBa_K091101 | pTet_Lac hybrid promoter | . . . ggaattgtgagcggataacaatttcacaca | 83 | 2516 | It's complicated | ||
| BBa_K091104 | pLac/Mnt Hybrid Promoter | . . . ggaattgtgagcggataacaatttcacaca | 87 | 1938 | It's complicated | ||
| BBa_K091105 | pTet/Mnt Hybrid Promoter | . . . agaactgtaatccctatcagtgatagagat | 98 | 1238 | It's complicated | ||
| BBa_K091106 | LsrA/cI hybrid promoter | . . . tgttgatttatctaacaccgtgcgtgttga | 141 | 2013 | It's complicated | ||
| BBa_K091107 | pLux/cI Hybrid Promoter | . . . acaccgtgcgtgttgatatagtcgaataaa | 57 | 4524 | It's complicated | ||
| BBa_K091143 | pLas/cI Hybrid Promoter | . . . ggttctttttggtacctctggcggtgataa | 164 | 1530 | It's complicated | ||
| BBa_K091146 | pLas/Lux Hybrid Promoter | . . . tgtaggatcgtacaggtataaattcttcag | 126 | 4661 | In stock | ||
| BBa_K091157 | pLux/Las Hybrid Promoter | . . . ctatctcatttgctagtatagtcgaataaa | 55 | 2254 | Not in stock | ||
| BBa_K094120 | pLacI/ara-1 | . . . aattgtgagcggataacaatttcacacaga | 103 | 1330 | It's complicated | ||
| BBa_K100000 | Natural Xylose Regulated Bi-Directional Operator | . . . gttacgtttatcgcggtgattgttacttat | 303 | 1977 | It's complicated | ||
| BBa_K101000 | Dual-Repressed Promoter for p22 mnt and TetR | . . . acggtgacctagatctccgatactgagcac | 61 | 2039 | Not in stock | ||
| BBa_K101001 | Dual-Repressed Promoter for LacI and LambdacI | . . . tggaattgtgagcggataaaatttcacaca | 116 | 1807 | Not in stock | ||
| BBa_K101002 | Dual-Repressed Promoter for p22 cII and TetR | . . . tagtagataatttaagtgttctttaatttc | 66 | 1947 | Not in stock | ||
| BBa_K109200 | AraC and TetR promoter (hybrid) | . . . aacaaaaaaacggatcctctagttgcggcc | 132 | 1535 | It's complicated | ||
| BBa_K112118 | rrnB P1 promoter | . . . ataaatgcttgactctgtagcgggaaggcg | 503 | 2103 | In stock | ||
| BBa_K112318 | {< bolA promoter>} in BBb format | . . . atttcatgatgatacgtgagcggatagaag | 436 | 2044 | It's complicated | ||
| BBa_K112322 | {Pdps} in BBb format | . . . gggacacaaacatcaagaggatatgagatt | 348 | 1848 | It's complicated | ||
| BBa_K112402 | promoter for FabA gene - Membrane Damage and Ultrasound Senstitive | . . . gtcaaaatgaccgaaacgggtggtaacttc | 256 | 4451 | It's complicated | ||
| BBa_K112405 | Promoter for CadA and CadB genes | . . . agtaatcttatcgccagtttggtctggtca | 370 | 4281 | It's complicated | ||
| BBa_K112406 | cadC promoter | . . . agtaatcttatcgccagtttggtctggtca | 2347 | 1785 | It's complicated | ||
| BBa_K112701 | hns promoter | . . . aattctgaacaacatccgtactcttcgtgc | 669 | 2559 | Not in stock | ||
| BBa_K116001 | nhaA promoter, that can be regulated by pH and nhaR protein. | . . . cgatctattcacctgaaagagaaataaaaa | 274 | 5780 | It's complicated | ||
| BBa_K116500 | OmpF promoter that is activated or repressesed by OmpR according to osmolarity. | . . . aaacgttagtttgaatggaaagatgcctgc | 126 | 1250 | It's complicated | ||
| BBa_K121011 | promoter (lacI regulated) | . . . acaggaaacagctatgaccatgattacgcc | 232 | 1333 | Not in stock | ||
| BBa_K136010 | fliA promoter | . . . gttcactctataccgctgaaggtgtaatgg | 345 | 2453 | It's complicated | ||
| BBa_K145150 | Hybrid promoter: HSL-LuxR activated, P22 C2 repressed | . . . tagtttataatttaagtgttctttaatttc | 66 | 2130 | It's complicated | ||
| BBa_K145152 | Hybrid promoter: P22 c2 , LacI NOR gate | . . . gaaaatgtgagcgagtaacaacctcacaca | 142 | 1431 | Not in stock | ||
| BBa_K259005 | AraC Rheostat Promoter | . . . ttttatcgcaactctctactgtttctccat | 340 | 1934 | It's complicated | ||
| BBa_K259007 | AraC Promoter fused with RBS | . . . gtttctccattactagagaaagaggggaca | 360 | 6988 | It's complicated | ||
| BBa_K266005 | PAI+LasR -> LasI & AI+LuxR --| LasI | . . . aataactctgatagtgctagtgtagatctc | 819 | 1498 | It's complicated | ||
| BBa_K266006 | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | . . . caccttcgggtgggcctttctgcgtttata | 1705 | 1471 | It's complicated | ||
| BBa_K266007 | Complex QS -> LuxI & LasI circuit | . . . caccttcgggtgggcctttctgcgtttata | 2676 | 1513 | It's complicated | ||
| BBa_R0065 | Promoter (lambda cI and luxR regulated -- hybrid) | . . . gtgttgactattttacctctggcggtgata | 97 | 3065 | In stock | ||
| BBa_S03385 | Cold-sensing promoter (hybB) | 1759 | No part sequence |