Part:BBa_K861110:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K861110

As for the genes we clone, there is no difference between E. coli str. K12 MG1655 and more available DH5α. we purified and amplified these genes from genome of Escherichia coli str. DH5α using PCR. The primers contain the standard restriction enzyme cutting sites. The sequences of the primers used are as below.

Antisense 5'CCTGCAGTACTAGTATTACTCGTTATCCGGGTTAAGAC3;

Sense　　5'CGAATTCTTCTAGAGATGAAAAGAAAACTATTCTGGATTTG3'
After amplifying by PCR, the DNA fragmentation was examined by agarose gel electrophoresis, the lads show that the sizes of the gene were correct.

User Reviews

UNIQ3605f0badbda1739-partinfo-00000001-QINU UNIQ3605f0badbda1739-partinfo-00000002-QINU