Part:BBa_K786003:Design
Sensory rhodopsin I (SRI) with HtrII & Tar, sensitive to orange light
- 10INCOMPATIBLE WITH RFC[10]Illegal SpeI site found at 37
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30
Illegal SpeI site found at 37 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 785
- 23INCOMPATIBLE WITH RFC[23]Illegal SpeI site found at 37
- 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 37
Illegal NgoMIV site found at 614
Illegal NgoMIV site found at 638
Illegal NgoMIV site found at 742
Illegal NgoMIV site found at 875
Illegal AgeI site found at 144
Illegal AgeI site found at 1616 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 977
Design and Construction Notes
Pfam (version 26.0) was used to predict the domain of fusion protein. Linker was refereed and modified from previous research study of SRI fusion with HtrII.
Restriction sites of HindIII and BamHI were added before and after the SRII gene respectively for two reasons. 1. Enable further integration of other peptides (e.g.: His-tag), for the construction of a larger fusion protein. (HindIII for N-terminal while, BamHI for C-terminal) 2. Enable for switching the sensory rhodopsin portion of the fusion protein. According to previous study. [2] A series of mutant sensory rhodopsins have been identified which covers a large variation of absorbing spectrum. These two restriction sites allow further switching of the sensing unit, so the light sensing system can be tuned for sensing different kinds of light source.
The speI RE site after the promoter was kept so that the constitutive promoter can be switched to strictly controlled promoters such as PTET, tetracycline-inducible promoter; PBAD, arabinose-inducible promoter.
Method of construction
Our team made use of a fast and convenient assembly method developed recently [4] to construct all of our biobricks in an effective way without the use of restriction enzymes and ligase - the direct transformation of prolonged overlap extension PCR products.
<p>Amplification of genes
Linear fragment DNA of the insert(s) and vector were amplified from corresponding templates by using specially designed primers which can add overlapping regions (40 bps per linear DNA) onto the DNA fragments.
Prolonged overlap extension PCR
Equal molar of insert(s) and vector DNA were added into a PCR reaction mix. The POE-PCR was conducted as follows: denaturation at 98°C for 30 s; 25 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 2.5 min.
Direct Transformation
Five microliter of the prolonged overlap extension PCR products was used to transform competent cells directly.
Constructs
List of primers
Primer# primer sequence
- TGAAAGAGGAGAAATACTAGAAGCTTATGGTGGGACTTACGACCCT
- CGCCGACGCGCCGTTCGACGCGGATCCGTCGGCGACCGCAGGCGTGT
- GGATCCGCGTCGAACGGCGCGTCGGCGATGTCGCTGAACGTATCACG
- TGCGCCAGTCGGTGCGGACAACCGTCGGTGATGTGCGCAA
- CTACACTAGCACTATCAGCGTTAAAATGTTTCCCAGTTCT
- AGAACTGGGAAACATTTTAACGCTGATAGTGCTAGTGTAG
- AGGGTCGTAAGTCCCACCATAAGCTTCTAGTATTTCTCCTCTTTCA
- TCGCGGACATGAGTGACGGTTGTCCGCACCGACTGGCGCA
- TGCGCCAGTCGGTGCGGACAACCGTCACTCATGTCCGCGA
- CTACACTAGCACTATCAGCGTCAAAATGTTTCCCAGTTTG
- CAAACTGGGAAACATTTTGACGCTGATAGTGCTAGTGTAG
- TGAAAGAGGAGAAATACTAGAAGCTTATGGACGCCGTCGCAACCGC
- TGCGCCAGTCGCTTCGTGGCACCGTCACTCATGTCCGCGA
- ATTCGCGGCCGCTTCTAGAGTCCCTTGCATTTACATTTTG
- ATCTAGTATTTCTCCTCTTTAGTCCATTCTCCCCAAAAAT
- CTAAAGAGGAGAAATACTAGATGGCTTCCTCCGAAGACGT
- CAAAATGTAAATGCAAGGGACTCTAGAAGCGGCCGCGAAT
- GGAAAGAGGAGAAATACTAGATGGCCACCACCGTACAACT
- CTAATGATGATGATGATGATGCCCTTCTTTTGTCATGCCCT
- CATCATCATCATCATCATTAGTACTAGTAGCGGCCGCTGCA
- ATCTAGTATTTCTCCTCTTTCCGGACCGCAGGCTGGCTAG
Phototactic Construct for Orange Light Detection
BBa_K786003
Primers 11, 12 were used to amplify sensory rhodopsin I (SRI) coding sequence from the genome of Halobacterium salinarum. Restriction sites of HindIII and BamHI were added.
Restriction sites of HindIII and BamHI were added before and after the SRI gene respectively in order to:
Primers 3 and 8 were used to amplify the coding sequence of HtrI from the genome of Halobacterium salinarum. A linker (GSASNGASA) that was proven not affecting the SR system [3] was added to joint SRI and HtrI.
Primers 11, 7 were used to amplify the promoter J23100 and J61002 backbone from biobrick BBa_J23100.
All of the parts amplified were added in PCR mix with equal molar to perform overlapping PCR and the PCR product was used for direct transformation.
The insert was later on switched to pSB1C3 backbone by using EcoRI and PstI restriction enzymes and T4 ligase.
The SpeI site after the promoter was kept so that the constitutive promoter can be switched to strictly controlled promoters such as Ptet (tetracycline-inducible promoter) and PBAD (arabinose-inducible promoter).
Source
From genomic sequence of Halobacterium Salinarum and E.coli K12.
References
[1] Vishwa D. Trivedi and John L. Spudich. Photostimulation of a Sensory Rhodopsin II/HtrII/Tsr Fusion Chimera Activates CheA-Autophosphorylation and CheY-Phosphotransfer in Vitro. Biochemistry 2003, 42, 13887-13892 BBa_K317028 </p>
[2] KWANG-HWAN JUNG, ELENA N. SPUDICH, VISHWA D. TRIVEDI, AND JOHN L. SPUDICH, An Archaeal Photosignal-Transducing Module Mediates Phototaxis in Escherichia coli, JOURNAL OF BACTERIOLOGY, Nov. 2001, p. 6365–6371
[3] Finn RD, Mistry J, Tate J, Coggill P, Heger A, Pollington JE, Gavin OL, Gunasekaran P, Ceric G, Forslund K, Holm L, Sonnhammer EL, Eddy SR, Bateman A., The Pfam protein families database., Nucleic Acids Res. 2010 Jan;38(Database issue):D211-22.
[4] Hoff WD, Jung KH, Spudich JL (1997). Molecular mechanism of photosignaling by archaeal sensory rhodopsins. Annu Rev Biophys Biomol Struct. 26: 223-258.
[5] Spudich JL, Yang CS, Jung KH, Spudich EN (2000). Retinylidene proteins: structures and functions from archaea to humans. Annu Rev Cell Dev Biol. 16: 365-392.
[6] Welch M, Oosawa K, Aizawa S, Eisenbach M (1993). Phosphorylation-dependent binding of a signal molecule to the flagellar switch of bacteria. Proc Natl Acad Sci U S A. 90: 8787-8791.