Part:BBa_K5407009
TEAD4 △105-109
Usage and Biology
TEAD4 isoform 1 were cloned by RT-PCR using RNA isolated from cells with primers (GCGGACTCCTTGGAACTGGCTTAG) and (CATCTTGGGTTTATTTG GGGTTGG) of TEAD4, respectively. The RT-PCR products were cloned to pTOPO vector (Invitrogen) and then subjected to DNA sequence analysis.
Design
We predicted the potential nuclear localization sequence of TEAD4, LARRK (105-109), using the PSORTⅡ software (https://psort.hgc.jp/). The forward and reverse primers of TEAD4-NLS were CTCCAGCCACATCCAGGTG/GCTCGCGA- GATCCAGGC and GCCTGGATCTCGCGAGC/CACCTGGATGTGGCTGGAG, in which the “ctggctcgtcgcaaa” sequence corresponding to putative nuclear localization signal LARRK (leu-105 to lys-109) was deleted. The first-round PCRs were carried out with TEAD4 cDNA as a template, with primers of EcorRI-TEAD4-F (5’-AACTCGAGTTGGAGGGCACGGCCGGCAC) and TEAD4-NLS-R, TEAD4-NLS-F and BamHI-TEAD4-R (5’-AAGGATCCTCATTCTTTCACCAGCCTG), respectively. The two PCR products were used as template for the second-round PCR with primers EcorRI-TEAD4-F and BamHI-TEAD4-R. The PCR product was sequenced and subcloned to pMMPc vector which number in Addgene is 116920. This generated cDNA sequence was later inserted into CRC cells.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 451
Illegal PstI site found at 668
Illegal PstI site found at 1258
Illegal PstI site found at 1444 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 451
Illegal PstI site found at 668
Illegal PstI site found at 1258
Illegal PstI site found at 1444 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 451
Illegal PstI site found at 668
Illegal PstI site found at 1258
Illegal PstI site found at 1444 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 451
Illegal PstI site found at 668
Illegal PstI site found at 1258
Illegal PstI site found at 1444
Illegal NgoMIV site found at 100
Illegal AgeI site found at 55
Illegal AgeI site found at 1157 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 378
Illegal BsaI site found at 1017
Illegal BsaI.rc site found at 1288
None |