Part:BBa_K515100:Experience

Applications of BBa_K515100

• The enzymatic reactions of the IAM pathway produce indole-3 acetic acid (IAA) which is an important phytohormone.
• Many Plant Growth Promoting Rhizobacteria produce IAA
• Analogues of phytohormones like α-Naphthaleneacetic acid are usually found in rooting powders. Therefore, if we were to express IAA in bacteria in a controlled fashion we could increase root growth.
• Increased root growth could help maintain top soil.
• Evidence has shown that using IAA on cotton can increase yields.

User Reviews

UNIQ13cb60ee308e2663-partinfo-00000001-QINU

••••• NUDT_CHINA 2015

This part is the only one available with IAAM and IAAH , but unfortunately, we noticed that neither of the CDS of those two enzyme were submitted to the registry (they were only registered as BBa_K515000 and K515001). Thus, several improvements were made based on the part K515100 to provide an available version of IAAM and IAAH. Two pairs of enzymes that can PCR-prep the CDS of IaaM and IaaH For IAAM F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGTTTGGACCGG-3’ R-Prime: 5’- GCGGCGGACTAGTCTTATTAGTCCCCCAGCG -3’ For IAAH F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGCGCGAAATG -3’ R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’ Two new bio-bricks were designed based on this part using the primers above See BBa_K1789000 and BBa_K1789001 Both of those parts were sent to the registry.

;

UNIQ13cb60ee308e2663-partinfo-00000003-QINU