Part:BBa_K5133000
T7 promoter (from plasmid pJL1)
Group: GEC-China (iGEM 2024, team number: #5133)
Brief introduction
This basic part is derived from plasmid pJL1 (Addgene: #69496)[1], including a conserved DNA sequence of T7 promoter as 5'-taatacgactcactatagggaga-3'[2]. The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[3]. Hence, this part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.
Design and characterization
The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. Result of Sanger sequencing shows the correct construction of this part (Figure 2).
Usages
This part is used for the construction of three composite parts: BBa_K5133004 (sfGFP generator), BBa_K5133006 (Microcin H47 generator), and BBa_K5133008 (Microcin M generator), for CFPS in our project.
DNA sequence (from 5' to 3')
atcccgcgaaattaatacgactcactatagggagaccacaacggtttccctctagaaataattttgtttaacttt
Red font: conserved T7 promoter
References
[1] https://www.addgene.org/69496/
[2] Conrad, T. et al. Maximizing transcription of nucleic acids with efficient T7 promoters. Communications Biology 3, 439 (2020). doi: 10.1038/s42003-020-01167-x
[3] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 51
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 51
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 51
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 32
| None |