Composite

Part:BBa_K5107012

Designed by: Georgios Retsinias   Group: iGEM24_DTU-Denmark   (2024-09-28)


T7-ERE5-dB-T

T7-ERE5-dB-T is a construct used in the cell free biosensor. The ERE5 is recognised by the steroid estrogen hormone receptor. Through this interaction, the in vitro transcription of a dimeric broccoli aptamer is controlled based on the presence of EDCs.

Usage and Biology

For the structure of the biosensor, we took inspiration from the ROSALIND cell-free biosensor[1], modifying their design to match our goals. We kept the general idea of having a Transcription Factor (TF) altering the activity of a RNA polymerase, and the output signal as a consequence. We tailored the ROSALIND concept by selecting specific custom transcription factors (TFs) as receptors and designing unique operator sequences to serve as responsive elements. The exact parts are described here:

Figure 1: Overview of the T7-HRE5-dB-T and T7-ERE5-dB-T DNA fragments used for the cell-free system. T7 promoter, response elements, aptamer parts and terminators are shown. Not to scale.
.

Cell free biosensor

This is the principal function of our designed biosensor

Cell-Free System Part 1
Figure 1: Cell-Free System - No Hormone/EDC in the environment.
Cell-Free System Part 2
Figure 2: Cell-Free System - Hormone/EDC in the environment.
When no EDC is present(Figure 1), the receptor will not bind the DNA, and thus the T7 RNAP is free to interact with the promoter, and transcribe the Broccoli aptamer. Once produced, the aptamer binds to the DFHBI-1T fluorophore, and enables fluorescence, by absorbing light at 472 nm and emitting it at 507 nm. When an EDC is present(Figure 2), it will bind the hormone receptor and induce a conformational change that will allow it to bind the receptor response element. Once the receptor is bound to the DNA, it will act as a repressor, suppressing the transcription from the T7 RNA promoter.


Assemply

We used USER cloning to assemble the T7-HRE5-dB-T and T7-ERE5-dB-T. For the design of the assembly we used the AMUSER tool https://services.healthtech.dtu.dk/services/AMUSER-1.0/. The USER assembly consists of 2 steps - PCR and the USER reaction.

  • First, we ran PCR reactions using primers from the AMUSER tool for the following parts:
  1. pUC19-T7-3WJdB-T(plasmid was a gift from Donald Burke (Addgene plasmid # 87308 ; http://n2t.net/addgene:87308 ; RRID:Addgene_87308))[2]
  2. HRE5 (BBa_K5107002)
  3. ERE5 (BBa_K5107004)

Each of the primers used to amplify a given response element part (HRE5, ERE5) was equipped with a specific USER overhang, complementary to the overhangs produced in plasmid backbone (pUC19-T7-3WJdB-T). For the PCRs, a Phusion U Hot Start polymerase that tolerates uracil bases was used. As a result, we obtained PCR products ready for USER cloning procedure.


  • USER cloning

USER cloning is a uracil-based excision technique that utilizes USER (Uracil-Specific Excision Reagent) enzyme to create specific 3’-overhangs on a DNA template. PCR products with double-strand USER overhangs (each containing uracil base) are subdued to the activity of USER and DpnI enzymes, resulting in an assembly of complementary overhangs and ligation of the templates.In our case, each of the responsive elements (HRE5, ERE5) was cloned into a backbone plasmid pUC19-T7-3WJdB-T. As a result, we produced two plasmids:

  1. pUC19-T7-HRE5-3WJdB-T (pUC19_HRE5)
  2. pUC19-T7-ERE5-3WJdB-T (pUC19_ERE5)


  • Validation
Primers for IVT Template
Forward Primer Reverse Primer
IVT Template gcggataacaatttcacacaggaaacagc caaaaaacccctcaagacccg

Table 1: Primer for IVT template amplification

Each plasmid was transformed into and amplified in E. coli strain DH5-α. The final IVT templates (T7-HRE5-dB-T and T7-ERE5-dB-T) were obtained by PCR of the target sequences containing only the DNA parts necessary for Cell-Free Transcription System(Table 1).Here it is shown only the gel electrophoresis of the T7-HRE5-dB-T(BBa_K5107006), but the principal is the same for the T7-ERE5-dB-T.

PCR validation of the ROSALIND templates
Figure 3: PCR validation of the cell free biosensor template(T7-HRE5-dB-T).

Test and Optimization

Data shown in BBa_K5107006


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 72
    Illegal PstI site found at 60
    Illegal PstI site found at 138
    Illegal PstI site found at 155
    Illegal PstI site found at 195
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 60
    Illegal PstI site found at 138
    Illegal PstI site found at 155
    Illegal PstI site found at 195
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 72
    Illegal PstI site found at 60
    Illegal PstI site found at 138
    Illegal PstI site found at 155
    Illegal PstI site found at 195
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 72
    Illegal PstI site found at 60
    Illegal PstI site found at 138
    Illegal PstI site found at 155
    Illegal PstI site found at 195
  • 1000
    COMPATIBLE WITH RFC[1000]



References

  1. Chen, R., Cheng, H., Jin, P., Song, L., Yue, T., Hull, M., & Mansell, T. J. (2020). Nature Biotechnology, 38(10), 1107–1112. https://doi.org/10.1038/s41587-020-0571-7
  2. Alam, K. K., Tawiah, K. D., Lichte, M. F., Porciani, D., & Burke, D. H. (2017). A Fluorescent Split Aptamer for Visualizing RNA–RNA Assembly In Vivo. ACS Synthetic Biology, 6(9), 1710–1721. https://doi.org/10.1021/acssynbio.7b00059

[edit]
Categories
Parameters
None