DNA
Part:BBa_K4769104:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
gyrA promoter 5’ integration sequence for B. subtilis 3610
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 667
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 667
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 726
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 667
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 667
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 200
Illegal SapI.rc site found at 625
Design Notes
N/A
Source
B. subtilis 3610 genome
Primers for cloning: FW: gaagcacggacgatcacc (+ desired overhangs) RV: aatatataggtattgcaggcatcgc (+ desired overhangs)