Part:BBa_K4743007:Design
prsA+ Adh1 terminator with adapter
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1167
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1167
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1167
Illegal BamHI site found at 16 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1167
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1167
Illegal AgeI site found at 1180 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
AAGGTACCGCAGGTGGGATCC is the forward primer of Adapter 1
TCACCGGTGCAGGTGGAATTC is the reverse primer of Adapter 2
Also, BamHI is included in adapter 1 and EcoRI is included in Adpater 2. These two site can be used for cloning
Source
B. amyloliquefaciens
References
1.Liu, Y., Yasawong, M., & Yu, B. (2021). Metabolic engineering of Escherichia coli for biosynthesis of β-nicotinamide mononucleotide from nicotinamide. Microbial biotechnology, 14(6), 2581–2591. https://doi.org/10.1111/1751-7915.13901
2.Gazzaniga, F., Stebbins, R., Chang, S. Z., McPeek, M. A., & Brenner, C. (2009). Microbial NAD metabolism: lessons from comparative genomics. Microbiology and molecular biology reviews : MMBR, 73(3), 529–541. https://doi.org/10.1128/MMBR.00042-08