Composite
Part:BBa_K4743004:Design
Designed by: Jen Hsien, Liu Group: iGEM23_PTSH-Taiwan (2023-09-16)
NadE+ADH1 terminator with adaptor
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1052
Illegal SpeI site found at 1045 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1052
Illegal NheI site found at 747
Illegal NheI site found at 823
Illegal SpeI site found at 1045 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1052
Illegal BamHI site found at 16 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1052
Illegal SpeI site found at 1045 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1052
Illegal SpeI site found at 1045
Illegal AgeI site found at 175
Illegal AgeI site found at 1065 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
AAGGTACCGCAGGTGGGATCC is the forward primer of Adapter 1
TCACCGGTGCAGGTGGAATTC is the reverse primer of Adapter 2
Also, BamHI is included in adapter 1 and EcoRI is included in Adpater 2. These two site can be used for cloning
Source
Francisella tularensis
References
1. Hughes, K. T., Olivera, B. M., & Roth, J. R. (1988). Structural gene for NAD synthetase in Salmonella typhimurium. Journal of bacteriology, 170(5), 2113–2120. https://doi.org/10.1128/jb.170.5.2113-2120.1988