![](https://parts.igem.org/images/partbypart/icon_coding.png)
Coding
Part:BBa_K4231001:Experience
Designed by: yang qingyan Group: iGEM22_USTC (2022-09-30)
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K4231001
We amplified ERG13 from the genome of Y.lipolytica W29 strain by PCR. A nucleic acid fragment ( GGTGGTGGTTCTTCTAAACTA ) encoding a peroxisome targeting signal sequence is added to the 3 ' end of the sequence
User Reviews
UNIQbb8f30e23b91096b-partinfo-00000000-QINU UNIQbb8f30e23b91096b-partinfo-00000001-QINU