Part:BBa_K3986004
ice crystal nucleoprotein（INP）
Can anchor passenger proteins to bacterial cell membranes
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 429
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 238
Determination of the expression position of the fusion protein
Verify the surface localization of INP-SerV protein by cell separation. SDS-page and western blot confirmed the expression of INP-SerV01 fusion protein in the outer membrane. After western blotting, it was found that the fusion protein was found in the EcN-IS bacterial total protein lysate (T) and the extracellular membrane fraction (OM) obtained by centrifugation, while no fusion protein was found in the intracellular membrane fraction (IM). Obvious banding. During the experiment, the empty EcN-pSB1A3 was used as a control, and it was found that there was no expression of fusion protein in the cytoplasm, intracellular membrane, and extracellular membrane components, as shown in Figure 3-2. The results show that INP-SerV01 uses INP-N as the anchor motif and is expressed on the outer membrane of E. coli Nissle 1917. Previous studies have shown that the specific band of the INP-FDH fusion protein appears in the OM fragment of E. coli expressing MBP-INP-FDH, but it is not in the predicted size of IM, cytoplasmic protein component or all subcellular component controls. Obvious bands were detected, indicating that the MBP-INP-FDH fusion protein has been successfully displayed on the cell surface [23]. The difference is that this experiment found that there are certain bands in the periplasmic component (S), so it is speculated that the fusion protein may be synthesized in the body first, and then anchored on the cell membrane surface.
Fig 3-2 Western bloting analysis of INP-SerV01 in different cell components. EcN-pSB1A3 were used as negative control.
Usage by team Nanjing_NFLS 2022
Team Nanjing_NFLS 2022 connected gene inaK and mlrA to construct an extracellular enzyme display system of microcystinase to degrade the microcystins in the environment. We linked the two genes consecutively onto the shuttle vector pET-23b, and then transformed it into the competent state of E. coli BL21 (DE3).
Restriction Endonuclease Digestion
The recombinant plasmid was then extracted to be identified with restriction endonuclease digestion. We separated the targeted gene inaK (537 bp) from the plasmid, and performed 20 rounds of PCR on it. This way, we obtained a larger quantity of the targeted gene, and the gel electrophoresis graph would be of better clarity. The sequence of the primers we used are listed as follows:
| Primer | Sequence (5’ to 3’) | Restriction Site |
|---|---|---|
| InaK-F | TCGAGCTCCGTCGACAAGCTTATGACTCTCGACAAGGCGTTG | HindIII |
| InaK-R | TTCCGCATGGTCTGCAAATTCTGCGGC | / |
TABLE 1 Primer sequences and Restriction Sites
We used a 200 bp ladder marker in gel electrophoresis. As shown in FIG.1, there were 3 significant bands respectively around 550 bp, 1000 bp and 1550 bp, each corresponding to inaK, mlrA and combination of the two. This indicated that the plasmid construction had been successful.
FIG.1 Restrictive Endonuclease Digestion Results
Identification of Protein Location
We separated different components of the cell by cell fractionation with ultracentrifuge. The samples of outer membrane, inner membrane and cytoplasm were obtained and stored at -4°C overnight. SDS-PAGE gel electrophoresis was performed the next day. We then used Coomassie Bright Blue to stain the gel and observe the proteins in each sample.
FIG. 2 SDS-PAGE Results after Coomassie Staining
The composite InaK + MlrA protein (56 kDa) was found in the outer membrane fraction of pET23b-inaK+mlrA transformed E. coli, verifying our construction. MlrA only (37 kDa) was found in the inner membrane fraction of pET23b-mlrA transformed E. coli, which matched previous literature’s observations. Overall, we verified the compatibility and location of the inaK-based enzyme display system.
Below is our protocol for cell fractionation: 1. The bacteria were grown at 37°C for 12h after 0.1mM IPTG induction.
2. Cells were collected by centrifuge of 6000 rpm for 10 min.
3. After 2 washes with PBS buffer, cells were resuspended in PBS containing 0.1mM EDTA and 10 μg/mL lysozyme.
4. After incubation of 2 hours on ice, the cell suspensions were treated with ultrasound sonication on ice (5 minutes, 1 cycle).
5. Intact cells were separated from the lysates with a slow centrifuge of 6000 rpm for 10 min.
6. At this point, the supernatant contained the whole cell lysates. We retrieved it with ultracentrifugation at 50,000 rpm for 1h to pellet the total membrane fraction.
7. The supernatant containing soluble cytoplasmic and periplasm fractions was collected and stored at -4°C for later assays.
8. The pellet of total membrane fraction was resuspended into PBS buffer containing 0.01 mM MgCl2 and 2% Triton X-100 for solubilizing the inner membrane, and incubated at room temperature for 30 minutes.
9. The suspension was ultracentrifuged again at 50,000 rpm for 1h. The supernatant contained the inner membrane proteins, and the pellet contained the outer membrane proteins.
10. All samples were collected and stored at -4°C for later assays.
FIG.3 Schematic of Cell Fractionation, Created with Biorender
References:
[1]. Li, L., Gyun Kang, D. and Joon Cha, H., 2004. Functional display of foreign protein on surface of Escherichia coli using N‐terminal domain of ice nucleation protein. Biotechnology and bioengineering, 85(2), pp.214-221.
[2]. Shi, H. and Su, W.W., 2001. Display of green fluorescent protein on Escherichia coli cell surface. Enzyme and microbial technology, 28(1), pp.25-34.
[3]. Liu, M., Ni, H., Yang, L., Chen, G., Yan, X., Leng, X., Liu, P. and Li, X., 2019. Pretreatment of swine manure containing β-lactam antibiotics with whole-cell biocatalyst to improve biogas production. Journal of Cleaner Production, 240, p.118070.
| None |