Part:BBa_K3930000

Linalool and dihydro-β-ionone induction system and expression in S. cerevisiae (pFLEUR) Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal XbaI site found at 1568
  Illegal XbaI site found at 1871
  Illegal XbaI site found at 6117
  Illegal XbaI site found at 6477
  Illegal SpeI site found at 4363
  Illegal SpeI site found at 8464
  Illegal PstI site found at 256
  Illegal PstI site found at 1213
  Illegal PstI site found at 1384
  Illegal PstI site found at 1887
  Illegal PstI site found at 3251
  Illegal PstI site found at 7610
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal NheI site found at 6555
  Illegal SpeI site found at 4363
  Illegal SpeI site found at 8464
  Illegal PstI site found at 256
  Illegal PstI site found at 1213
  Illegal PstI site found at 1384
  Illegal PstI site found at 1887
  Illegal PstI site found at 3251
  Illegal PstI site found at 7610
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BglII site found at 293
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal XbaI site found at 1568
  Illegal XbaI site found at 1871
  Illegal XbaI site found at 6117
  Illegal XbaI site found at 6477
  Illegal SpeI site found at 4363
  Illegal SpeI site found at 8464
  Illegal PstI site found at 256
  Illegal PstI site found at 1213
  Illegal PstI site found at 1384
  Illegal PstI site found at 1887
  Illegal PstI site found at 3251
  Illegal PstI site found at 7610
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal XbaI site found at 1568
  Illegal XbaI site found at 1871
  Illegal XbaI site found at 6117
  Illegal XbaI site found at 6477
  Illegal SpeI site found at 4363
  Illegal SpeI site found at 8464
  Illegal PstI site found at 256
  Illegal PstI site found at 1213
  Illegal PstI site found at 1384
  Illegal PstI site found at 1887
  Illegal PstI site found at 3251
  Illegal PstI site found at 7610
  Illegal AgeI site found at 2074
  Illegal AgeI site found at 2840
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI site found at 2396
  Illegal BsaI site found at 6658
  Illegal BsaI.rc site found at 1534
  Illegal SapI site found at 8626
  

Introduction

The pFLEUR part (BBa_K3930000) enables the production of linalool from GPP, dihydro-β-ionone from β-ionone and is composed by:

- up (BBa_K3930004) and down (BBa_K3930005) integration sites in the XII-1 locus (Chr XII: 795787..796720) of the S. cerevisiae genome (based on the plasmid pCfB3038 from Easyclone Marker free kit (Jessop-Fabre et al.,2016)).

- lis (BBa_K3930008) and dbr1 (BBa_K3930009) genes that allows the production of linalool and dihydro-β-ionone. The sequences were codon optimized for an expression into S. cerevisiae.

- the expression block for Z3eV activator of the promoter Z3eV (BBa_K3930006).

- inducible promoters with estradiol (BBa_K3930007) and Cup1 (BBa_K1969005), driving the expression of both lis and dbr1.

- the resistance marker hygR (BBa_K39300011) to select yeast integrants.

Construction

IDT performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with the In-Fusion Takara kit into the pCfB3038 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of a correct resulting clone.

Figure 1: pFLEUR assembly

pFLEUR restriction profile from clone 7 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel (note that a different ladder is presented on the theoretical gel)

The plasmid containing the pFLEUR construct was then linearized with the pFLEUR_pCfB3038_Forward and pFLEUR_pCfB3038_Reverse linearization primers. Then the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of PCR on colony to verify clones.The expected size was obtained for clone 3.

Primer used to clone this part in the pCfB3038:

• pFLEUR_pCfB3038_Forward : 5' agaaagtataggaacttctgaag 3'
• pFLEUR_pCfB3038_Reverse : 5' catacagcgtgacaataatg 3'

Figure 2: Integration of pFLEUR in LycoYeast

pFLEUR integration from clone 1, 2 and 3 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel (note that a different ladder is presented on the theoretical gel).

pFLEUR insertion at locus XII-1 was successful. The integrant strain was named LycoYeast-pFLEUR and saved as glycerol stock.

Characterization

Production of dihydro-β-ionone

The strain LycoYeast-pFLEUR was cultivated and induced for the expression of DBR1 by adding copper to the culture medium in late exponential phase. After waiting for the enzymes to be produced, the yeast cells were lysed in TRIS-HCl pH 6.5 buffer. The activity was studied by GC-MS using β-ionone as substrate, adapting the method described by Zhang et al. (2018). Assays contained 50 mM TRIS-HCl (pH 6.5), 1 mM NADPH, 2 mM dithiothreitol (DTT), 1 mM β-ionone and 500 μL of the yeast lysate in a total volume of 1 mL at 45 °C for 1.5 h. At the beginning and end of the incubation, 200 µL of the mix was collected and then a liquid-liquid extraction was carried out by vortexing the sample with 200 µL of dodecane. The dodecane phase was then analyzed by GC-MS.

Figure 3 shows the GC-MS spectrum for the LycoYeast-pFLEUR strain. A peak can be observed at the same retention time as the dihydro-β-ionone standard for the induced LycoYeast-pFLEUR strain only. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The dihydro-β-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology). The production of dihydro-β-ionone in vitro was successfully achieved with a lysate of a LycoYeast expressing this construction.

Figure 3: GC-MS analysis of the dodecane layer of the LycoYeast-pFLEUR

dihydro-β-ionone is produced in vitro by our strain when it is induced by copper. On the right are presented the mass spectra that correspond between the standard and the observed peak.

Conclusion and Perspectives

These results show that pFLEUR allows for the conditional production of dihydro-β-ionone from β-ionone. In perspectives, it remains to be verified that this part works as well in vivo. No experience has been conducted to produce and detect linalool since its signal was masked by our dodecane extraction. This part of the construction remains to be characterized

The dihydro-β-ionone belongs to the terpene family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.

References

1. Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.
2. Zhang X, Liao S, Cao F, Zhao L, Pei J, Tang F. 2018. Cloning and characterization of enoate reductase with high β-ionone to dihydro-β-ionone bioconversion productivity. BMC Biotechnol. 18:26. doi:10.1186/s12896-018-0438-x.