Part:BBa_K3916006
PTT5-RBD-his-B.1.1.7
PTT5-RBD-his-B.1.1.7
Profile
Name: PTT5-RBD-his-B.1.1.7
Base Pairs: 5111bp
Origin: A transient protein expression vector for lactating cells
Properties: A plasmid used to express the protein of RBD
Usage and Biology
The S glycoprotein is the immunodominant target for previous NAbs, and comprises an N-terminal domain (NTD), a receptor-binding domain (RBD/S1B), and an S2 subunit. The SARS-CoV RBD [amino acids (aa) 338–506] consists of an S1B core domain (S1BCD) (aa 318–424) and a receptor-binding motif (RBM) (aa 438–498) that directly engages the human receptor hACE2. Meanwhile, The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry.
Construct design
We aimed to construct the plasmid to give the protein (RBD) synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.
The profiles of every basic part are as follows:
BBa_K3916000
Name: pTT5
Base Pairs: 4401bp
Origin: A transient protein expression vector for lactating cells
Properties: A vector used for protein expression
Usage and Biology
pTT5（BBa_K3916000） is a mammalian expression vector with 4401bp, which itself has ampicillin resistance. Promoter is CMV，Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG; Primers for 3'sequencing: based on sequence design. In this project, we created two plasmids(pTT5-S1 &pTT5-RBD) using the pTT5 backbone to benefit our project as well as any group wishing to conduct coronavirus research. This is important because it provides other researchers intending to study coronaviruses with tools (plasmids) for further research, thus saving steps, materials and time.
BBa_K3916004
Name: RBD
Base Pairs: 669bp
Origin: Viral protein binding sites
Properties: Used for protein expression
Usage and Biology
BBa_K3916004 is the coding sequence of a kind of protein (RBD). Coronavirus pneumonia (Coronavirus disease 2019, COVID-19) infects the human body with pneumonia caused by the combination of S protein on its surface with angiotensin-converting enzyme 2 (ACE2) receptors. Mutations in the S1 protein in the S protein and its receptor binding domain (RBD) can lead to changes in viral infection capacity and may lead to immune escape. The RBD is also a significant neutralization determinant in the inactivated SARS-CoV vaccine because it induces potent NAbs that block SARS-CoV entry. In this project, we aimed to construct a plasmid to give the protein of RBD synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.
Experimental approach
We constructed the plasmid then used the method of PCR to replicate the fragment of RBD-800 bp. Moreover, we did enzyme cutting then homologous recombination. Finally we could extract the plasmid for subsequent experiment.
Electrophoresis is designed to verify the genetic success of our purpose (RBD). We can find this is successful.
Purification of protein Remove DH5α receptor cells from -80°C and place on ice to melt. Add 20 μl of recombinant plasmid product to the strain, flick the wall of the tube, place on ice for 30 min, heat excites in a water bath at 42°C for 45 s, and then place on ice for 2 min to cool. Add 1000μl LB medium (without antibiotics), shake at 37°C, 220 rpm, and incubate for 60 min. Centrifuge at 5000 rpm for 5 min at room temperature, discard 900 μl supernatant and mix the remaining medium and cells by blowing. Take 100μl of bacterial solution evenly coated on pre-warmed ampicillin-resistant (Amp+) plates and incubated overnight at 37℃ in an inverted incubator; The next day picks monoclonal colonies in 20μl LB liquid medium and take 2μl for PCR sequencing of the bacterial broth to confirm successful recombination. The remaining 18μl was added to 1ml Amp+ LB and incubated for 6-8 hours at 37℃ in the shaker, 220rpm.
Proof of function
The fast-evolving of coronaviruses, such as SARS-CoV-2, makes broad-spectrum coronavirus preventional or therapeutical strategies highly sought after. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development. 3E8 Binds Human ACE2 With Moderate Affinity
We measured the binding affinity of 3E8 to His-tagged human ACE2 protein with ELISA and biolayer interferometry (BLI). The EC50 value was 15.3 nM in ELISA (Fig. 4A) and the dissociation constant (KD) was 30.5 nM in BLI (Fig. 4B). It is also bound to HEK293F cells ectopically overexpressing human ACE2 and to Vero E6 cells endogenously expressing human ACE2, as demonstrated by flow cytometry (Fig. S1E).
References
1.Assistant Secretary for Public Affairs (ASPA). (2021, June 28). Monoclonal Antibodies for High-Risk COVID-19 Positive Patients. combatCOVID.hhs.gov. 2. Boopathi, S., Poma, A. B., & Kolandaivel, P. (2021, June). Novel 2019 coronavirus structure, mechanism of action, antiviral drug promises and rule out against its treatment. Journal of biomolecular structure & dynamics. 3. Centers for Disease Control and Prevention. (n.d.). Test for Current Infection. Centers for Disease Control and Prevention. 4. Huang, Y., Sun, H., Yu, H., Li, S., Zheng, Q., & Xia, N. (2020, December 28). Neutralizing antibodies against SARS-CoV-2: current understanding, challenge and perspective. Antibody therapeutics.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 125
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 1563
Illegal SapI.rc site found at 1776
| None |