Part:BBa_K3916000

PTT5

PTT5

Profile

Usage and Biology

pTT5（BBa_K3916000） is a mammalian expression vector with 4401bp, which itself has ampicillin resistance. Promoter is CMV，Primers for 5'sequencing: CMV-F:CGCAAATGGGCGGTAGGCGTG; Primers for 3'sequencing: based on sequence design. In this project, we created two plasmids(pTT5-S1 &pTT5-RBD) using the pTT5 backbone to benefit our project as well as any group wishing to conduct coronavirus research. This is important because it provides other researchers intending to study coronaviruses with tools (plasmids) for further research, thus saving steps, materials and time.

Construct design

We aimed to construct the plasmid with the vector pTT5 to give the protein (S1&RBD) synthesized from B138 the ability to perform the protein purification and ELISA testing as well as to mimic the property held by the spike protein of the coronavirus.

Figure 1. Map of pTT5-S1-RBD-his-B117 expression plasmids..

Figure 2. Plasmid Map of pTT5expression..

Proof of function

The fast-evolving of coronaviruses, such as SARS-CoV-2, makes broad-spectrum coronavirus preventional or therapeutical strategies highly sought after. Our results highlighted again the importance of epitope outside or on the verge of RBD/ACE2 interface and would facilitate future endeavors searching for broad-spectrum anti-coronavirus approaches. Overall, we presented evidence that 3E8 is a promising therapeutic candidate for the coronavirus pandemic and believe that it represents a significant conceptual advance in fighting COVID-19, which keeps evolving and may open the door for more ACE2-targeting drug discovery and development. 3E8 Binds Human ACE2 With Moderate Affinity

Figure 3. Monoclonal antibody 3E8 and recombinant S1-subunits or RBD from different coronaviruses (and SARS-CoV-2 mutant variants) bound to His-tagged recombinant human ACE2 protein: (A) Binding of 3E8 to His-tagged recombinant human ACE2 protein as measured by ELISA; (B) Binding of 3E8 to His-tagged human ACE2 as measured by BLI; (C-G) Bindings of recombinant S1-subunits or RBD (in F only) from multiple coronaviruses and SARS-CoV-2 mutated variants to recombinant human ACE2 protein as measured by ELISA; (H) The EC50 values of recombinant S1-subunit bindings to human ACE2..

We measured the binding affinity of 3E8 to His-tagged human ACE2 protein with ELISA and biolayer interferometry (BLI). The EC50 value was 15.3 nM in ELISA (Fig. 3A) and the dissociation constant (KD) was 30.5 nM in BLI (Fig. 3B). It is also bound to HEK293F cells ectopically overexpressing human ACE2 and to Vero E6 cells endogenously expressing human ACE2, as demonstrated by flow cytometry (Fig. S1E).

References

1.Assistant Secretary for Public Affairs (ASPA). (2021, June 28). Monoclonal Antibodies for High-Risk COVID-19 Positive Patients. combatCOVID.hhs.gov. 2. Boopathi, S., Poma, A. B., & Kolandaivel, P. (2021, June). Novel 2019 coronavirus structure, mechanism of action, antiviral drug promises and rule out against its treatment. Journal of biomolecular structure & dynamics. 3. Centers for Disease Control and Prevention. (n.d.). Test for Current Infection. Centers for Disease Control and Prevention. 4. Huang, Y., Sun, H., Yu, H., Li, S., Zheng, Q., & Xia, N. (2020, December 28). Neutralizing antibodies against SARS-CoV-2: current understanding, challenge and perspective. Antibody therapeutics.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BglII site found at 125
  
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]