Coding

Part:BBa_K3807017:Experience

Designed by: Viktoriia Belousova   Group: iGEM21_KU_Leuven   (2021-10-01)


This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K3807017

sfGFP was fused to a TetA gene through a flexible linker (encoded by GGATCCGCTGGCTCCGCTGCTGGTTCTGGCGAATTC). sfGFP serves as a reporter, whose expression level is measured by a spectrophotometer or flow-cytometer, for the expression level of TetA. The quantitative measurement of protein expression level was used to report the characteristics of theophylline riboswitches put directly upstream of this TetA-sfGFP gene.

User Reviews

UNIQe14e6710ac450f2f-partinfo-00000000-QINU UNIQe14e6710ac450f2f-partinfo-00000001-QINU