Part:BBa_K3380500:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K3380500
The construct can be tested in 2 different media: cell-free extract or optimised transcription/detection buffer (OTRDB). This particular construct was tested in OTRDB buffer (explained below), however we also have the cell-free extraction protocol below.
Acquired parts
The parts needed for this construct were ordered (synthesized de novo) as follows:
BBa_z0251 (class III, strong promoter)
Forward:
5’ GGAG gaaattaatacgactcactatagggagaccacaac 3’
Reverse:
5’GGGA gttgtggtctccctatagtgagtcgtattaatttc 3’
BBa_K3380101 (F30 scaffold upstream)
Forward:
5’ TCCC ttgccatgtgtatgtggg 3’
Reverse:
5’AGTA cccacatacacatggcaa 3’
BBa_K3380150 (iSpinach fluorescent RNA aptamer)
Forward:
5’TACT agacgcgactacggtgagggtcgggtccagtagcttcggctactgttgagtagagtgtgggctccgtagtcgcgtctc 3’
Reverse:
5’CATT gagacgcgactacggagcccacactctactcaacagtagccgaagctactggacccgaccctcaccgtagtcgcgtct 3’
BBa_K3380102 (F30 scaffold downstream)
Forward:
5’ AATG cccacatactctgatgatccttcgggatcattcatggcaa 3’
Reverse:
5’ AAGC ttgccatgaatgatcccgaaggatcatcagagtatgtggg 3’
Note: The 4bp in Capital letters are 4bp scars to allow swapping of the parts to test different constructs.
Oligos phosphorylation
1. The tubes containing the lyophilized oligonucleotides were span briefly (30 s, 2000 xg) to ensure that the pellet is at the bottom of the tube.
2. Nuclease free water was added to obtain a final concentration of 100 μM. The tube contents were mixed by flicking the tube, and span briefly (30 s, 2000 xg) to ensure that all liquid is at the bottom of the tube. the tubes were placed on ice.
3. The oligonucleotides were phosphorylated by combining the following in a 0.2 ml clear PCR tube:
| Components | Stock concentrations | Volume |
| Forward part | 100 μM | 10 μl |
| Reverse part | 100 μM | 10 μl |
| T4 PNK buffer (NEB) | 10x | 2.5 μl |
| T4 Polynucleotide Kinase | 0.25 μl | |
| ATP | 10 mM | 2.5 μl |
4. The tubes were mixed by flicking them, and span briefly (30 s, 2000 xg) to return all liquid to the bottom of the tube. Further the tubes were placed in a heat-block and incubated for 30 min at 37°C.
5. To anneal, the tubes with the phosphorylated oligonucleotides were placed in a heat-block at 95°C. The the tubes were allowed to slowly cool down by turning off the heat-block, and letting them to cool down to room temperature.
6. The tubes were further stored at -20℃.
Ligation
1. Ligation was performed in a sequential order, by firstly ligate 1 (promoter BBa_z0251) and 2 (F30 upstream scaffold BBa_K3380101) or 3 (iSpinach BBa_K3380150) and 4 (F30 downstream scaffold BBa_K3380102) in separate tubes in parallel, which then mixed to ligate 12 and 34 to generate a complete construct (1234).
2. Each part was added to a PCR tube on ice as following for the first ligation [1+2 or 3+4]:
| Concentration | Volume | |
| Upstream clip (1 or 3) | 40 μM | 2 μl |
| Downstream clip (2 or 4) | 40 μM | 2 μl |
| T4 ligase buffer + ATP (NEB) | 10x (10 mM) | 1 μl |
| T4 ligase | 0.5 μl | |
| Nuclease free water | 4.5 μl |
3. The tubes were mixed by flicking them and further were span briefly (30 s, 2000 xg) to return all liquid to the bottom of the tube. Further, they were incubated at 16°C for 1h.
4. To generate the complete construct, 5μl of sample were taken from each previously ligated tubes and mixed into a new PCR tube. The tubes were incubated at 16°C for 1h. Note: this time could be extended since the ligation efficiency could be improved depending on the results from the gel.
5. The tubes were placed in a pre-warmed heat-block (or water bath) and incubated at 65°C for 10 min to inactivate T4 DNA ligase. The tubes were span briefly (30 s, 2000 xg), and placed on ice. The tubes were stored at -20°C. Before use, defrost thoroughly on ice and spin the tubes briefly (30 s, 2000 xg). Keep the tubes on ice when in use.
6. To check the quality of the Clips, the construct were analysed on a 2% agarose gel run at 90v for 30mins.
In vitro Transcription using the OTRDB buffer
1. The following were added to perform the reconstituted in vitro transcription
| Sample | Positive control |
Negative Control | |||
| with characterized template | without template | without RNAP | |||
| Concentration | Volume | Volume | Volume | Volume | |
| Sample | 1 μl (up to 100 ng) | 1 μl | 0 | 1 μl | |
| Nuclease-free water | 13.25 μl | 13.25 μl | 13.25 μl | 14 μl | |
| OTRDB | 10x | 2 μl | 2 μl | 2 μl | 2 μl |
| Fluorophore (DFHBI) | 200 μM | 1 μl | 1 μl | 1 μl | 1 μl |
| NTPs | 20mM | 2 μl | 2 μl | 2 μl | 2 μl |
| T7RNAP | 0.75 μl | 0.75 μl | 0.75 μl | 0 | |
2. The reaction was allowed to proceed at room temperature.
3. Fluorescence was imaged under a Safe Imager™ Blue-Light Transilluminator (Invitrogen) with an amber filter unit and a phone camera, which could be observed 5 mins after the reaction started.
Note The OTDB (or OTRDB) buffer was prepared as a 10X stock as follows: Tris base 400 mM pH 7.5 adjusted with HCl (Sigma-Aldrich, #T1503); MgCl2 6(H2O) 60 mM (Sigma-Aldrich, #M2670); DTT 100 mM (Melford, #MB1015) and Spermidine 20 mM (Alfa Aesar, #A19096.03). Source [1]
The T7 RNA polymerase was purchased from Sigma-Aldrich#R0884 50000U/ml.
Cell culture
1. The E. coli K12 MG1655 (in our case it was E.coli) were grown on agar plate in Luria Broth (LB), and incubated at 37℃ overnight.
2. One colony was picked from the plate.
3. The picked colony E.coli colony was grown in 300ml M9 minimum culture at 160 rpm at 37℃ overnight.
4. The cell culture was collected at OD600 = 2, into six 50ml falcon tubes.
5. The cells were pelleted by spinning at 4500 RPM for 20 mins at 4℃.
6. The cell pellets were stored at -20℃ for later use.
Cell Lysis
1. 6 tubes with the pellets were placed on ice and 3 ml of non-ionic lysis buffer [(0.1% v/v Triton X-100(Sigma-Aldrich#T9284), 40 mM Tris base adjusted to pH 7.5 with HCl and 50 mg/ml of lysozyme (Sigma-Aldrich#L6876)] was added to each pellet for cell resuspension.
2. The tubes were washed with 1 ml non-ionic lysis buffer to resuspend the pellets.
3. The resuspended cells were transfered in a new 50 ml falcon tube.
4. 0.5 mg/ml lysozyme (stock concentration: 50mg/ml) was added to the cells.
5. The solution was kept on ice (4℃) for 1h to allow the reaction to fully react.
6. The tubes were then centrifuged at 4℃, 10000 ⅹg for 20 mins. Further, the supernatant was collected in 20 1ml Eppendorf tubes, labelled from 1-20.
7. Tube 1 and 2 were used for Bradford assay, tube 3 and 4 were used for runoff treatment and then Bradford assay.
Runoff (nucleic acid degradation)
The tube 3 and 4 was shook at 160 rpm for 2h at 37℃.
Braford assay for cell extract protein concentration (Microplate protocol, Working Range = 100-1500µg/mL)
1. Every standard/sample was done in triplicates
2. 5 ul of each standard or unknown sample was placed into the appropriate microplate wells (e.g., Thermo Scientific™ Pierce™ 96-Well Plates, Product No. 15041).
3. 250µL of the Coomassie Reagent was added to each well and mixed with plate shaker for 30 seconds.
4. Further the plate was removed from the shaker. For the most consistent results, the plate was incubated for 10 minutes at room temperature (RT).
5. The absorbance was measured at 595nm with a plate reader.
6. Further the average 595nm measurement for the Blank replicates was substracted from the 595nm measurements of all other individual standard and unknown sample replicates.
7. A standard curve was prepared by plotting the average Blank-corrected 595nm measurement for each BSA standard vs. its concentration in µg/mL. The standard curve was used to determine the protein concentration of each unknown sample. Note: The complete protocol can be found in [2]
User Reviews
UNIQ69aaa09a973119d8-partinfo-00000000-QINU UNIQ69aaa09a973119d8-partinfo-00000001-QINU