Part:BBa_K3311009
copperA promoter fusion Riboj 2
It is improve part according to BBa_K2826008 (iGEM18_ASTWS-China) The BBa_K3311008 was inserted between copperA promoter (BBa_K2088001) and Riboj (BBa_K1679038).
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 945
Illegal AgeI site found at 1057 - 1000COMPATIBLE WITH RFC[1000]
Description & Design
Instead of replacing pCopA of a new copper induced promoter, we changed another way to improve BBa_K2826008: Adding a translation enhancing sequence, BBa_K3311008 (part of BBa_K1758100), which could improve the efficiency of translation initiation, into the existed composite part. A T7 g10 leader sequence “AATAATTTTGTTTTAACTTTAA” and a poly-A-spacer “AAAAAAAAAA” were included in the enhancer. It showed that the enhancer had the ability of further improve the heterologous gene expression efficiency in E. coli (BBa_K1758100, iGEM15_Bielefeld-CeBiTec ). We hypothesized that if the enhancer works well, the improved cultures should have stronger fluorescence after CuSO4 inducing that much higher than the background fluorescence caused by pCopA “leakage”.
Results and Discussion
We compared BBa_K3311009 with BBa_K2826008 by culcuring under different concentration of CuSO4 solution (0mg/L to 80 mg/L).Surprisingly, we found that the experimental results were different from what we thought: when no Cu2+ was added to the medium, the red fluorescence value of test group BBa_K3311009 was lower than the control group BBa_K2826008 (Figure 1). We wished to increase the sensitivity of BBa_K2826008 in response to CuSO4 treatment by adding a translation enhancing sequence to the original promoter. However, the enhancer element did not solve this problem, but unexpectedly solved the problem of leakage expression at the basal condition. That is to say, we reached our goal by accident.
After analyzing the fluorescence inhibiton ratio, we found that the inhibition to the fluorescence leakage in BBa_K3311009 is stable, which is not affected by different concentration of Cu2+. With the increase of induction time (from 0h to 12h), the effect of fluorescence suppression in BBa_K3311009 is weakened, which shows that the enhancing sequence can effectively respond to copper（Figure 2). Then we calculated the fluorescence growth rate of in two groups after inducing for 12 hours (Figure 3). We found that the fluorescence growth rate of BBa_K3311009 is higher than BBa_K2826008. Although the total fluorescence value is lower, the fluorescence difference between 0h and 12h becomes larger in BBa_K3311009. All of this proves that we have achieved a reasonable result to some extent in this attempt.
At the same time, we tried our best to find out the reason of expression inhibiting caused by enhancing sequence through literature. We got that the interaction between enhancer and promoter is more complicated than previously appreciated [1]. It was reported that the regulatory elements within one species’ promoter may not be recognizable by an acting factor present in another species [2]. Generally, expression at constitutive level could better cooperate with the enhancers [3]. Inducible promoters may require some conditional induction, which may cause allosteric effect on ribosome and mRNA. As a result, the enhancer may not function well or even reduce the expression of genes.
Reference
[1] Krivega, Ivan, and Ann Dean. "Enhancer and promoter interactions—long distance calls." Current opinion in genetics & development 22, no. 2 (2012): 79-85.
[2] Li, Zhijian, Subramanian Jayasankar, and D. J. Gray. "Expression of a bifunctional green fluorescent protein (GFP) fusion marker under the control of three constitutive promoters and enhanced derivatives in transgenic grape (Vitis vinifera)." Plant science 160, no. 5 (2001): 877-887.
[3] Khoury, George, and Peter Gruss. "Enhancer elements." Cell 33, no. 2 (1983): 313-314.
| None |