Plasmid

Part:BBa_K3022000

Designed by: Zhanyu Gao   Group: iGEM19_Nanjing-China   (2019-08-28)


The ppk1 in Citrobacter freundii ATCC 8090

The polyphosphate kinase in Citrobacter freundii ATCC 8090 is responsible for its intracelluar inorganic polyphosphate (polyP) production via reversibly catalyzing the transfer of terminal phosphate from ATP to a growing polyP chain. This organism is our chasiss, in which its native PPK1 will be overexpressed with a plasmid of medium-copy numbers. Although PPKs from E. coli and C. freundii shares 96% identity, the C. freundii PPK1 has a glutamate and a lysine residue in positions 327 and 328, where E. coli PPK1 has much less strongly charged alanine and glutamine residues. These natural mutations of C. freundii PPK1 are distant from the PPK1 active site and found in interfaces between monomers of the PPK1 tetramer.This leads to a dramaticl increase of intracellular polyP accumulation.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1871
    Illegal XbaI site found at 1901
    Illegal SpeI site found at 1895
    Illegal PstI site found at 635
    Illegal PstI site found at 1877
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1871
    Illegal SpeI site found at 1895
    Illegal PstI site found at 635
    Illegal PstI site found at 1877
    Illegal NotI site found at 1907
    Illegal NotI site found at 4820
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1871
    Illegal BglII site found at 422
    Illegal BamHI site found at 1889
    Illegal XhoI site found at 1838
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1871
    Illegal XbaI site found at 1901
    Illegal SpeI site found at 1895
    Illegal PstI site found at 635
    Illegal PstI site found at 1877
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1871
    Illegal XbaI site found at 1901
    Illegal SpeI site found at 1895
    Illegal PstI site found at 635
    Illegal PstI site found at 1877
    Illegal NgoMIV site found at 1086
    Illegal NgoMIV site found at 1369
    Illegal NgoMIV site found at 2548
    Illegal AgeI site found at 2388
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 935
    Illegal SapI.rc site found at 1145

The polyphosphate kinase in Citrobacter freundii ATCC 8090 is responsible for its intracelluar inorganic polyphosphate (polyP) production via reversibly catalyzing the transfer of terminal phosphate from ATP to a growing polyP chain. This organism is our chasiss, in which its native PPK1 will be overexpressed with a plasmid of medium-copy numbers. Although PPKs from E. coli and C. freundii shares 96% identity, the C. freundii PPK1 has a glutamate and a lysine residue in positions 327 and 328, where E. coli PPK1 has much less strongly charged alanine and glutamine residues. These natural mutations of C. freundii PPK1 are distant from the PPK1 active site and found in interfaces between monomers of the PPK1 tetramer.This leads to a dramaticl increase of intracellular polyP accumulation.

Wild-type Citrobacter freundii ATCC 8090 was purchased from China Center of Industrial Culture Collection (CICC, China). For the construction of pBBR1MCS2-ppk1, genomic DNA of Citrobacter f.reundii was used as the template to PCR-amplify ppk1 with primers. After confirmation by sequencing, the PCR product was digested with Kpn I and Hind III and then insert into pBBR1MCS2 (pBR322 ori) to yield pBBR1MCS2-ppk1.

Genomic DNA of Citrobacter f.reundii was used as the template to PCR-amplify ppk1 with PPKF and PPKR primers. After confirmation by sequencing, the PCR product was digested with Kpn I and Hind III and then insert into pBBR1MCS2 (pBR322 ori) to yield pBBR1MCS2-ppk1. The Citrobacter f.reundii transformed with pBBR1MCS2-ppk1 was selected from LB agar plates containing 50 mg/L kanamycin, and the resulting strain was designated bacteria.

PPKF 5’GGGGTACCAATGGGTCAGGAAAAGCTATACATCG

PPKR 5’CCCAAGCTTTTAGTCAGGTTGCTCGAGTGATTTG


[edit]
Categories
Parameters
None