Part:BBa_K3021004:Design
NSP4-Laccase1326-HisTag
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 1493
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1007
Illegal BamHI site found at 1526
Illegal XhoI site found at 227 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 136
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 862
Design Notes
Laccase sequence is codon optimized from previous iGEM team, which was initiated based on Trametes versicolor; and the secretion peptide, NSP4, is also codon optimized, sequence from E.coli based from a previous publication.
Source
The original NSP4 sequence from the paper is ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG with the Protein sequence is The n-region: MKKI(the positive net charge in the n-region: +2) The h-region: TAAAGLLLLA The c-region: AQPAMA; We have codon optimized this sequence and also the Laccase1326 sequence, which is from previous publication.
References
References: Han, S., Machhi, S., Berge, M., Xi, G., Linke, T., & Schoner, R. (2017). Novel signal peptides improve the secretion of recombinant Staphylococcus aureus Alpha toxinH35L in Escherichia coli. AMB Express, 7, 93.