Part:BBa_K2946013

TS11

Part one of a logic AND gate circuit based on trans - splicing events (TS). This reaction designed to take place between the transcripts of two exogenously introduced modules. Similarly to TS1(BBa_K2946010), the promoter of this module is SSX1p. In module TS11, immediately 3’ to exon 1 of mKate2 we inserted the first 50 bp of the mKate2 intron (Figure 1)

In order to fully preserve the strong donor splice site and to provide a linker preceding the TS guiding sequence. Here we have chosen to adapt the optimized TS elements which have recently been reported in (8). This paper describes in full detail the design of RNA structures, which improve both activity and specificity of TS-mediated targeting of the herpes simplex virus thymidine kinase coding sequence to the endogenous alpha-fetoprotein (AFP) transcript, as suicide gene therapy of cancer. In particular, we have chosen the optimized 50 bp sequence derived from intron 5 of AFP (NCBI Reference Sequence: NG_023028.1). Yet, adapting exactly the same sequence as in (8) poses a problem as the AFP gene is expressed in HEK293 cells (as shown in Fig. S1C in (8)) and the expected TS may be dampened by binding to the endogenous transcript. In order to avoid such an undesired outcome yet preserve the favorable properties of the selected stretch, we have simply chosen to invert the 50 bp sequence from intron 5. The inverted sequence also preserves an artificial 2-base mismatch, introduced by the Patzel group “to prevent formation of long nuclear double-stranded RNA, which could trigger antisense effects” (8). The final TS guiding sequence in module 1 is (mismatch is marked):

5’TGGAGAGATTTGGATTTTTTTTAAAAGAAGAGATTTGGAGAAAGGATCAA 3’

This TS guiding sequence is followed by a 34bp linker and the HSV1pA poly A site, as in (1). This pre- mRNA designed to attach to another synthetic pre-mRNA (module TS12) if present in order to create a full mRNA of our gene of interest (GOI - MKate2) by trans splicing. By itself it will not form a transcriptable RNA code and will not produce protein

In this system, the output protein is expressed only when the promoters regulating both modules are mutually active. However, when only one of the promoters is active or when none of the promoters are active, they cannot produce any functional protein. thus, standing alone, is permanently in state ‘0’.

We defined two different states for this circuit: in state [1,0], module 1 is active, while module 2 is inactive (off); and in state [1,1], both module 1 and module 2 are active (on).

Results

Expression in HEK293T cells -the data below display the transient transfection of HEK293T cells with plasmids containing LoGENEgate by flow cytometry. Any expression below the negative control (<3.09%) is irrelevant, hence amounts to 0% expression of GOI. As expected in [1,0] states there is no product, 0% expression