Part:BBa_K2942705:Design
pSB1A3 with CMV promoter and eGFP
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 2134
Illegal suffix found in sequence at 1 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 2134
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9
Illegal NotI site found at 2140 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 2134
- 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 2134
Illegal suffix found in sequence at 2 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 2134
Illegal XbaI site found at 2149
Illegal SpeI site found at 2
Illegal PstI site found at 16 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1173
CMV promoter+eGFP
CMV promoter is recognized as the most powerful promoter to start the gene expression of eukaryon. Here we also insert eGFP which is a type of GFP derivatives by mutation to assess the effect of the gene expression in eukaryon. eGFP mutation greatly improved the spectral characteristics of GFP, resulting in increased fluorescence, photostability, and a shift of the major excitation peak to 488 nm, with the peak emission kept at 509 nm[1]. This matched the spectral characteristics of commonly available FITC filter sets, so it could be used by the researcher more efficiently, such as using it in mammalian cells.
The CMV(BBa_I712004) and eGFP(BBa_I914891) was linked into the vector pSB1A3 between the restriction sites EcoRI and PstI using the Multiple fragment homologous recombination. The primer designing and the experiment procedure were consistent with the protocol of the ClonExpress® MultiS One Step Cloning Kit, and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1), sequencing of the recombinant plasmid (Fig.2)and the image of transfection cells observed under a fluorescence microscope (Fig.3).
Primers for homologous recombination:
PSBA3-F AACTGCAGTCCGGCAAAAAAGGGCAAG
PSBA3-R CGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGG
CMV-F TAAGGATGATTTCTGGAATTCGTGATGCGGTTTTGGCAGT
CMV-GFP-R TCCTCGCCCTTGCTCACCATAGCTCTGCTTATATAAACCT
GFPF ATGGTGAGCAAGGGCGAGGAGCTGT
GFPR CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG
Primers for PCR:
F TTCGCTAAGGATGATTTCTGGAATTC
R CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG
Primers for sequencing:
F TTCGCTAAGGATGATTTCTGGAATTC
R CTTGTACAGCTCGTCCATG
Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above.
Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can download the sequence files on the mian page.
Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. Fluorescence was observed 24h after the transfection.
In conclusion, this result well confirmed that CMV+eGFP transformant certainly can be used to express the gene of interest and show its expression in eukaryu.
[1] Pédelacq JD, Cabantous S, Tran T, Terwilliger TC, Waldo GS (Jan 2006). "Engineering and characterization of a superfolder green fluorescent protein". Nature Biotechnology. 24 (1): 79–88. Sequence and Features
Design Notes
We choose the restrict enzyme sites EcoRI and PstI to cut the vector pSB1A3 to insert these two sequences,and we use the stick end cut by restrict enzyme PacI to link promoter and eGFP.
Source
The promoter and eGFP was cloned from other plasmids, and we attach them to the vector which was kindly provided in the iGEM DNA kit.