Part:BBa_K2878004
GLS-shRNA-2 template
This DNA oligo is GLS-shRNA-2 transcription template (GGCGTACATCGATCAACGTCCTTGCTTCGACGTTGATCGATGTACGCCTT), We use this template for GLS-shRNA-2 generation through in vitro transcription system. GLS-shRNA-2 is designed to silence Phyllotreta striolata Glutathione S-transferase gene, the target site on the Glutathione S-transferase mRNA is 576-596 after AUG
1. Usage
In our project, GLS-shRNA-2 was used to silence Arginine Kinase gene of phylotreta striolata. GLS-shRNA-2 solution (10ng/ml) can be sprayed on leaves of cruciferous plants, ingestion of the GLS-shRNA-2 by P. striolata will induce the RNAi mechanism in the insect and lead to its death.
2. Biology
Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.
The target site for GLS-shRNA-2 on the Arginine Kinase mRNA is 576-595 after AUG. Arginine kinase participates in arginine metabolism, transferring phosphorus group from ATP to arginine. When gene for Arginine Kinase is silenced, phylotreta striolata is killed.
3. Characterization
3.1 Design of GLS-shRNA-2
GLS-shRNA-2 was designed based on the mRNA sequences of Aldose Reductase. Factors that affect in vitro transcription efficiency, such as the requirement of a ‘GG’ dinucleotide at the start of the transcript; and factors that affect RNAi efficiency, such as distance of target region to transcription start site, nucleotide composition, and the presence of asymmetry and energy valley within the shRNA; were considered.
These criteria include:
Target site:
Not being in the first 75 bases from the start codon
Not being in the intron.
Nucleotide content of siRNA:
GC content of ~50% GC content.
UU overhangs in 3′-end (increase siRNA stability)
Weak base pairing at 5′-end of the antisense strand (presence of A/U)
Strong base pairing at 5′-end of the sense strand (presence of G/C)
5′-end of the antisense strand start with C (Insect agoraute2 prefers 5’ C)
Based on these criteria, GLS-shRNA-2 that may target the Phyllotreta striolata Aldose Reductase genes was designed (Table 1).
| shRNA | GLS-shRNA-2 |
| Sequence | 
|
| GC% of antisense strand | 48 |
| GC% at 5′-end of antisense strand | 48 |
| GC% at 3′-end of antisense strand | 48 |
| Target site | 576-595 after AUG |
3.2 In vitro transcription of GLS-shRNA-2
1) DNA Oligo Template Design
For primer 1, convert the sense strand of the siRNA sequence to the corresponding DNA sequence, add a 17 base T7 promoter sequence (TAATACGACTCACTATA) to the 5’end of the DNA sequence, add an 8 base loop sequence to the 3’-end of the DNA sequence. For primer 2, add the antisense sequence complementary to the loop sequence to the 3’-end of the DNA sequence. add 2 AA’s to the 5’-end of the Primer 2 oligo. DNA Oligos (Table 2) were ordered.
| Primers for DNA oligo template | Primers |
| GLS-shRNA-2 | P1: 5’ TAATACGACTCACTATAGGCGTACATCGATCAACGTCCTTGCTTC 3’ P2: 5’ AAGGCGTACATCGATCAACGTCGAAGCAAG 3’ |
2) Fill-in reaction to generate GLS-shRNA-2 transcription templates
Each fill-in Reaction was set up with two Oligos
1.0 µl P1 Oligo (100 pmoles)
1.0 µl P2 Oligo (100 pmoles)
2.0 µl 10 x buffer 2 (NEB)
0.5 µl 50 X dNTPs (10 mM)
0.5 µl Klenow Fragment exo– DNA Polymerase (5 U/ ml)
15 µl RNase-Free Water
20 µl Total reaction volume, incubate the reaction mixtures for 2 hours at 37ºC, then 25 min at 75 ºC, cool at room temperature for 2 minutes.
The integrity of GLS-shRNA-2 templates was identified through 3% agarose gel eletrophoresis (Fig. 1). Agarose gel electrophoresis showed that the GLS-shRNA-2 template was successfully generated. Sharp bands can be seen on the gel, and the size of the bands is around 67 bases, which is the correct size.
3) In vitro transcription
1. in vitro transcription reaction was set up using the prepared template.
10.7 µl RNase-Free Water
2.0 µl Fill-In Reaction product
2.0 µl 10 x T7 RNA Polymerase Buffer (NEB)
2.8 µl 100mM MgSO4 (NEB)
1.0 µl NTP Mix (80 mM each NTP)
1.5 µl T7 RNA Polymerase (50 U/ µl)
20 ul Total reaction volume
2. Incubate the reaction mixtures for 2-3 hours at 37ºC.
3. Add 1 µl RNase-Free DNase I (1 Unit/ml) to remove the DNA template, 37ºC 15 min.
4. Heat the reaction mixtures for 15 minutes at 70ºC to inactivate the enzyme.
5. Extract with Phenol/Chloroform.
a. Add 100 µl RNase-Free Water to dilute the reaction.
b. Add 120 µl phenol/chloroform and vortex briefly to mix.
c. Spin in a microfuge for 1 minute at full speed.
d. Carefully pipette off the top aqueous phase and transfer to a clean tube.
6. Precipitate the shRNA.
a. To the recovered aqueous phase, add 1/10 vol. of 3 M Sodium Acetate (pH 5.2).
b. Add 2.5 volumes of 95-100% ethanol.
c. Incubate for 15 minutes on ice.
d. Pellet the shRNA in a microfuge by spinning at full speed for 15 minutes.
e. Remove the supernatant.
f. Carefully wash the pellet once with 70% ethanol.
g. Air dry the pellet for only 2-5 minutes.
7. Add 100 µl of the 1 X Annealing Buffer to the shRNA pellet and resuspend the shRNA.
The procedure of the shRNA in vitro transcription system is illustrated in Fig. 2.
The integrity of GLS-shRNA-2 was identified through 3% agarose gel eletrophoresis (Fig. 3) Agarose gel electrophoresis showed that the GLS-shRNA-2 was successfully transcribed. Sharp bands of around 50 bases in length were detected on the gel, the size of the bands is correct.
3.4 RNAi efficiency test
Adult P. striolata were obtained from Shenzhen University field station, and kept in glass bottles. The tissue culture seedlings of Chinese cabbage, Brassica chinensis leaves were placed into the above bottles (Fig. 4).
The solutions of GLS-shRNA-2 (10 ng/mL) was sprayed onto the leaves of Chinese cabbage every third day, each solution has two repeats. Around twenty adult beetles of P. striolata were tested per siRNA/shRNA sample. The survival rates of adult beetles, were recorded at different days after GLS-shRNA-2 treatment.
Results show that, GLS-shRNA-2 could trigger RNAi mechanism, which was demonstrated by the significant survival rate decrease after treatment, while the negative control sample showed slight survival rate decrease.
4. References
[1] Baum J.A., Bogaert T., Clinton W., Heck G.R., Feldmann P., Ilagen O., Johnson S., Plaetinck G., Munyikwa T., Pleau M., Vaughn T., Roberts J. 2007: Control of coleopteran insect pests through RNA interference. Nat. Biotech. 25: 1322–1326.
[2] Gorden K.H. & Waterhouse P.M. 2007: RNAi for insect-proof plants. Nat. Biotech.25: 1231–1232.
[3] Macrae I.J., Zhou K., Li F., Repic A., Brooks A.N., Cande W.Z., Adams P.D., Doudna J.A. 2006: Structural basis for double-stranded RNA processing by Dicer. Science. 311 (5758): 195–8.
[4] Mao Y.B., CAI W.J., WANG J.W., HONG G.J., TAO X.Y., WANG L.J., HUANG Y.P., CHEN X.Y. 2007: Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotech. 25: 1307–1313.
[5] Turner C.T., Davy M.W., Macdiarmid R.M., Plummer K.M., Birch N.P., Newcomb R.D. 2006: RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double-stranded RNA feeding. Insect Mol. Biol. 15: 383–391.
[6] Wang M, Weiberg A, Lin F M, et al. Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection[J]. Nature Plants, 2016, 2(10):16151-16151.
[7] Zhao Y.Y., Yang G., Pruski W., You M.S. 2008: Phyllotreta striolata (Coleoptera: Chrysomelidae): arginine kinase cloning and RNAi-based pest control. Eur J Entomol 105: 815–822.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |