Part:BBa_K2651000
Strong Promoter(J23110), RBS (B0034), and PETase CDS with Amil-CP reporter gene
Strong promoter from J23110 with a strong RBS B0034 followed by PETase, which is an enzyme-coding sequence that degrades PET (Polyethylene terephthalate) to its monomer counterpart, Mono-2-hydroxyethyl terephthalate (mHET).
Description: Wild type PETase was used as a control for our tests of the modified PETase enzyme. This circuit was put together with gibson assembly to add it to a J23110 constitutive promoter and the k1357009 amilCP reporter gene with a double terminator. The control PETase was used to compare the rates of the modified PETase to ensure that the modifications work correctly and faster than the wild type.A PELB tag was added to the PETase enzyme to excrete it from the cell so plastic degradation can occur properly.
Characterization:
Plate showing transformed cells with PET circuit and some blue colonies expressing the blue amilCP gene
Extracted Protein that remained blue because of the amilCP reporter
Data for this part and the plastic degradation of the PETase has been inconclusive. The pH of the media the cells were growing in was raised to 10 to improve the function of the PETase enzyme. However, this may have slowed the growth of the E. coli so that they were not able to produce the enzymes at a fast enough rate. To test the effectiveness of the PETase enzyme, future tests could include different microbes to test in and different conditions like temperature or pH.
PETase with PelB tag:
atgaatttcccccgcgcgagccgcctgatgcaggctgctgtcctggggggtctgatggccgtttcggccgctgcaaccgcgcaaactaatccgtacgcac
gtggtccgaatccgacagccgccagccttgaggcgagtgcgggtccgttcactgtacgctcgtttaccgtctctcgcccgtcgggctacggtgccggaac
ggtttattacccgaccaacgcagggggtacggttggagctatcgcaatcgtccctggttatacggcccgccaaagctctatcaaatggtggggacctcgt
ttagcatcccatgggtttgtcgtaattactatcgataccaacagcactttagatcaaccgtcatctcgctcgtcacaacagatggccgcattacgtcagg
tagcatcgcttaacgggacaagttcaagcccaatttatgggaaagtagacacagctcgtatgggcgtcatgggacactctatgggcggtgggggttctct
gattagtgctgctaataacccgagtctgaaggccgctgcgccgcaagcaccatgggattcgtccactaacttcagcagtgtgacagttcccacgttaatc
tttgcatgtgagaatgacagtatcgcaccggtaaactcctccgcactgccaatctatgactcaatgtctcgcaacgcaaaacagtttctggaaattaatg
gcgggagtcatttctgtgctaattctggtaactcaaaccaggcattaatcgggaaaaaaggagtggcgtggatgaagcgcttcatggataacgatacgcg
ctacagcaccttcgcttgcgaaaatccaaattcgacccgtgtcagtgactttcgcacagcgaactgttctatgaaatacctgctgccgaccgctgctgct
ggtctgctgctcctcgctgcccagccggcgatggcc
Usage and Biology
Contribution:ULaverne_Collab
ULaverne_Collab 2019:
Team ULaverne_Collab characterized this PETase part (BBa_K2651000) by using the ImageJ program. The part was ran on a protein gel and was expected to be at 28.6 kDa. The protein gel results are as follows:
Figure 1. SDS page showing Amil CP (Negative control), and the kDa of PETase, Mutant PETase, and MHetase.
The expected kDa did not have a single band as it was smeared mostly. There was a hint of a band so the analysis continued by using the ImageJ program to quantify the relative density of the PETase part. The percentage was found based on the selected area of the part comparing it to the negative control of the experiment, Amil CP. This percentage value was then divided by the percentage of the reference (Amil CP) in order to obtain the relative density. The result is as follows:
Figure 2. Bar Graph showing relative densities for Amil CP (used as the standard), PETase, Mutant PETase, and Mhetase.
The graph displays the relative density of the PETase part in comparison to Amil CP which served as the negative control. The relative density of PETase was 1.04, signifying the fold-increase was by 1.04. This shows that the PETase protein was not being expressed as thought and needs to be further characterized to have a correct kDa.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 115
- 1000COMPATIBLE WITH RFC[1000]
| None |