Plasmid_Backbone
Part:BBa_K2649002:Design
Designed by: Alexandrea Pouliot Group: iGEM18_MIT (2018-10-12)
RFP SB1C3 w/ SapI
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 247
Illegal XbaI site found at 220
Illegal PstI site found at 208 - 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 247
Illegal PstI site found at 208 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 247
Illegal BamHI site found at 226 - 23INCOMPATIBLE WITH RFC[23]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 247
Illegal XbaI site found at 220
Illegal PstI site found at 208 - 25INCOMPATIBLE WITH RFC[25]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 247
Illegal XbaI site found at 220
Illegal PstI site found at 208 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal BsaI site found at 1
Illegal BsaI.rc site found at 598
Design Notes
Primer Information
Forward (iGEM 46 RFP SapI Primer): gaattcgcggccgcttctagagagcggaagagccaatacgcaaaccgcc
Reverse (iGEM 40 RFP SapI Reverse Primer): tactagtcactgaagagctataaacgcagaaaggccc
Tm: 62 degrees for both primers
PCR at 63 degrees - Adds the SapI binding and cut sites to the beginning and end of the RFP construct to allow for insertion of Lab parts and adds certain BioBrick sites (EcoRI, NotI, and XbaI to the beginning, SpeI to the end) for insertion into the iGEM SB1C3 backbone. XbaI and SpeI have the same sticky ends, so had to extend to use whole prefix.