Part:BBa_K2342000:Experience
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K2342000
The part codes for the expression of Dermcidin derived DCD-1L peptide. Dermcidin is a recently discovered antimicrobial peptide (AMP) found in primates with no homology to other know AMPs (1). It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense. Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as DCD-1 and DCD-1L. DCD-1L is one of the most abundant form of dermcidin derived peptide. DCD-1L is a 48 amino acid long anionic peptide active against wide spectrum of bacteria including Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes.
In DCD-1L has overall net charge -2 with cationic N-terminal region and anionic C-terminal region. N-terminal of DCD-1L (1 to 23), first interacts with bacterial membrane initially and allows peptides placement on membrane surface, followed by formation of a hexameric pore that further is stabilized by Zn+2 ions and under low pH sweat conditions(2). Also, the fact that DCD-1L is amphipathic, supports alpha helix structure and insertion into phospholipid bilayer.
In our project we produced this in E.coli using a SUMO fusion and His6x Tag. For more details on the production and usage of this part please check the composite part page: BBa_K2342006, BBa_K2342007, BBa_K2342008
Promoter information
In our project we used pET28a(+) vector. The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid. (ref. Novagen pET System Manual: https://research.fhcrc.org/content/dam/stripe/hahn/methods/biochem/pet.pdf )
References
Schittek, B., Hipfel, R., Sauer, B., Bauer, J., Kalbacher, H., Stevanovic, S., ... & Rassner, G. (2001). Dermcidin: a novel human antibiotic peptide secreted by sweat glands. Nature immunology, 2(12), 1133-1137.
Paulmann, M., Arnold, T., Linke, D., Özdirekcan, S., Kopp, A., Gutsmann, T., ... & Bürck, J. (2012). Structure-activity analysis of the dermcidin-derived peptide DCD-1L, an anionic antimicrobial peptide present in human sweat. Journal of Biological Chemistry, 287(11), 8434-8443.
User Reviews
UNIQfab78c1a53d1c79a-partinfo-00000000-QINU UNIQfab78c1a53d1c79a-partinfo-00000001-QINU