Part:BBa_K2273107:Design

Evaluation Vector with P_xylA to screen for protein specific secretion efficiency

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BamHI site found at 247
  
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal NgoMIV site found at 1354
  Illegal AgeI site found at 1348
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI site found at 266
  

Figure 1: Three color stages of the EV. All agar plates shown contain X-Gal and IPTG. A The EV without any inserts. B The EV with an inserted Signal Peptide and gene of interest. C The EV with RPFsyn2 and an inserted gene of interest.

Design Notes

As stated on the main page of this part, we aimed for an easy cloning and screening procedure in our cloning host Escherichia coli. To accomplish that, we chose to set the construct RFPsyn2 as placeholder for the N-terminally fused protein and the gene lacZα for the C-terminally fused protein, respectively.

Therefore, the blue color of lacZα carrying colonies and thereby X-Gal degrading colonies masks the red color of the RFPsyn2 on X-Gal containing agar plates (Figure 1, A). However, on not X-Gal containing agar plates, the red color of the RFPsyn2 will be visible. This applies to colonies not carrying lacZα, too (Figure 1, B). E. coli colonies carrying neither lacZα nor RPFsyn2 will stay whitish as common E. coli colonies (Figure 1, C). By applying this setup, successfully transformed E. coli colonies can be identified easily.

Source

As our project was based on the Gram-positive model organism Bacillus subtilis, we decided to use a previously well-evaluated B. subtilis vector as source for our Evaluation Vector: the integrative vector pBS1C1 (Radeck et al., 2013). In brief, the vector has the following features for cloning in E.coli: an ori of replication and the bla gene mediating resistance against ampicillin. The B. subtilis specific part of the vector contains the multiple cloning site (MCS) in RFC10 standard, a cat cassette providing resistance against chloramphenicol and flanking regions needed for integration into the amyE locus. (For a detailed description of the original vector features please have a look at Radeck et al., 2013)

A confirmed BsaI restriction free version of the vector pBS1C was cut with EcoRI and XbaI to insert the xylose inducible promoter P_xylA (Radeck et al., 2013) which was prior amplified using the following set of primers:

iG17P051	gatcgaattcgcggccgcttctagagaaggccaaaaaactgctgcc
iG17P052	gatcgctagcgagaccttcgataagcttgggatccc

Following the amplification, we digested the PCR product with EcoRI and BsaI (resulting in an XbaI overhang) to maintain the BioBrick prefix in front of the promoter.followed by digestion with EcoRI and BsaI (resulting in an XbaI overhang) to maintain the BioBrick prefix in front of the promoter.

Next, we had to create an entirely new multiple cloning site (MCS): We synthesized a new RFP based on the sequence of the RFP found in the pSB1C3 backbone. The expression of this RFPsyn2 is still driven by the IPTG inducible P_lacI promoter but lacks any restriction enzyme sites interferring with the RFC25 standard. Additionally, we added an AgeI restriction enzyme site downstream of the RFP coding sequence which is necessary for translational fusions.

Furthermore, we amplified a lacZα fragment with AgeI and NgoMIV restriction enzyme sites upstream of the coding sequence and the RFC10 BioBrick standard as suffix using the following set of primers:

iG17P055	gatcaccggtgccggcgcgcaacgcaattaatgtgag
iG17P056	gatcctgcagcggccgctactagtatataaacgcagaaaggcccac

Finally, we combined our new MCS, by ligating the digested RFPsyn2 (cut with XbaI and AgeI) with the lacZα fragment (cut with AgeI and PstI). This MCS was inserted into the pBS1C-P_xylA backbone, which was prior opened using BsaI (resulting in an XbaI overhang) and PstI (Figure 2).

Figure 2: Cloning scheme of the Evaluation Vector. The detailed cloning workflow which led to the finished Evaluation Vector construct with the pBS1C backbone.

The final construct of our EV was then cut with EcoRI and PstI to be cloned into the pSB1C3 backbone and verified by sequencing prior to the submission to the partsregistry.

References

Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013) The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7, 29. PubMed