![](https://parts.igem.org/images/partbypart/icon_composite.png)
Composite
Part:BBa_K2207015:Design
Designed by: Junming Qian Group: iGEM17_ZJU-China (2017-10-26)
PhlBD enzyme
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 1582
Illegal XbaI site found at 3794
Illegal PstI site found at 776
Illegal PstI site found at 3806 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 776
Illegal PstI site found at 3806 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1494
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 1582
Illegal XbaI site found at 3794
Illegal PstI site found at 776
Illegal PstI site found at 3806 - 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 1582
Illegal XbaI site found at 3794
Illegal PstI site found at 776
Illegal PstI site found at 3806
Illegal NgoMIV site found at 1298 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 486
Illegal BsaI.rc site found at 2279
Illegal SapI site found at 168
Design Notes
We used the F2A sequenece(gtgaaacagactttgaattttgaccttctcaagttggcgggagacgtggagtccaaccctggacct)to link the phlB with phlD, and then combined them to eGFP to construct a fusion protein so that the two genes can be transcribed as a single mRNA and generating two independent gene products, and meanwhile we can identify whether the proteins are expressed by detecting the fluorescent.
Source
We successfully cloned the phlBD via colony PCR from Pseudomonas fluorescens 2P24, which is a gift from Prof. Liqun Zhang of China Agriculture University.
References
Jin H K, Lee S R, Li L H, et al. High Cleavage Efficiency of a 2A Peptide Derived from Porcine Teschovirus-1 in Human Cell Lines, Zebrafish and Mice[J]. Plos One, 2011, 6(4):e18556.