![](https://parts.igem.org/images/partbypart/icon_composite.png)
Part:BBa_K1395003:Design
sqr gene (sulfide quinone reductase) and cysI gene (sulfur reductase) under constitutive promoter
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1997
Illegal PstI site found at 1463 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1997
Illegal NheI site found at 7
Illegal NheI site found at 30
Illegal PstI site found at 1463 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1997
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1997
Illegal PstI site found at 1463 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1997
Illegal PstI site found at 1463
Illegal NgoMIV site found at 1736
Illegal NgoMIV site found at 1922
Illegal NgoMIV site found at 2064
Illegal AgeI site found at 1436 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 390
Illegal BsaI site found at 1472
Illegal BsaI site found at 2794
Design Notes
Cys1 gene have restriction site for EcoR1 and Pst1 and therefore was not compatible for 3A assembly. To clone this part using 3 assembly we amplify the part using primers containing site for different restriction enzyme but having same flanking sequences. Cys1 gene was our part B in the 3A assembly, so it was to be restricted digested by Xba1 and Pst1. Hence, we designed primers such that at rear end part had a site of Nsi1 which has same flanking sequence as that of Pst1. Now this PCR amplified part was restriction digested with Nsi1 and Xba1. pSB1C3 (plasmid backbone) was digested with EcoR1 and Pst1. Then both parts were ligated with backbone using 3A assembly.
Cys1-FP:: ATGTCTAGAGAGGAGGAAAAAAATGTACGTATACGACGAG Cys1-RP:: CCAATGCATCCTGCAGCGGCCGCTACTATATTAATGATTC
We designed this Biobrick as mentioned we had used a constitutive promoter Bba_J23119 (member of Anderson family). This promoter consists the RBS itself. This was succeeded by part for sqr gene (Bba_K896000) . Then we were constrained to apply any RFC10 further so we designed primers for Cys1 which also contains commonly used RBS Sequence (Shine Dalgarno Sequence).
Source
Basically this Biobrick is a composite part which is created by two genes regulated by same constitutive promoter. This is made up of parts which we got from biobricks Bba_K896000 and Bba_K896001. Out of these Biobricks Bba_K896000 encodes sulfide quinone reductase (Source Synechococcus sp. PCC 7002) and Bba_K896001 encodes sulfite reductase, Cys1 (Source:Pseudomonas aeruginosa strain PAO1).