Part:BBa_J64804
The promoter region (inclusive of regulator binding sites) of the B. subtilis RocDEF operon
This is the reported promoter region from the Bacillus subtilis RocDEF operon as taken from the DBTBS website (http://dbtbs.hgc.jp/). Base 1 to base 21 contains the binding site for the binding factor, RocR. The sequence, TATGCAAAAGAATTTTGCACT, reportedly contains the consensus sequence for binding of this factor. Base 42 to base 62 contains another binding site for the RocR binding factor, with ATATCAGAATGTTTTTGCACC as the binding consensus for this sequence. Bases 113-135 outline the binding site of the binding factor AhrC (CTTGCATTTATATAAAGGGAAAG). Bases 96 to 135 outline the promoter region for this operon (CTTGATTTGGCACAGAACTTGCATTTATATAAAGGGAAAG).
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 91
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 91
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 91
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 91
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 91
- 1000COMPATIBLE WITH RFC[1000]
//direction/forward
//chassis/prokaryote/ecoli
//promoter
//regulation/positive
//regulation/multiple
negative_regulators | |
positive_regulators | 2 |