Other
Part:BBa_I716331:Design
Designed by: nhu nguyen Group: iGEM07_Berkeley_UC (2007-07-02)
ThpA
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 29
Illegal PstI site found at 590 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 29
Illegal PstI site found at 590 - 21INCOMPATIBLE WITH RFC[21]Illegal prefix found in sequence at 29
Illegal suffix found in sequence at 575 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 29
Illegal PstI site found at 590 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 29
Illegal PstI site found at 590
Illegal AgeI site found at 1060 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 496
Design Notes
This part is built in Biobrick version 2.0. In this format, parts are flanked by BglII and BamHI restriction sites.
Source
PCR ThpA F/R on ThpA (553bp, BglII/XhoI)
Sub into pBca9145-Bca1144 (BglII/XhoI, 2054+910, L)
Product is pBca9145-BBa I716331
ThpAF Forward BglII site anneals to ThpA cgtacAGATCTatgaccgccgcaccagcagattttgcccgtgcccgaagcgaGttcctcagtatcg
ThpAR Reverse XhoI site anneals to ThpA anneals to XhoI cgcatctcgagtcaggtggcgaacgggccta