DNA/Primer binding sites

< Back to DNA parts

ForwardPrimerBindingSite.png
Primer binding sites are DNA sequences specifically designed for oligo annealing. For example, most BioBrick plasmid backbones include binding sites for the VF2 and VR primers.
ReversePrimerBindingSite.png


More...
NameDescriptionSequenceLength
BBa_G00000BioBrick cloning site prefixgaattcgcggccgcttctagag22
BBa_G00001BioBrick cloning site suffixtactagtagcggccgctgcag21
BBa_G00100Forward primer for sequencing/amplifying BioBrick parts (VF2)tgccacctgacgtctaagaa20
BBa_G00102Reverse BioBrick primer annealing site (VR binding site)gctcactcaaaggcggtaat20
BBa_K3464000Forward Primer for the detection of ancestral allele of the rs4149056tctgggtcatacatgtggatatatgt26
BBa_K3464001Forward Primer for the detection of alternative allele of the rs4149056tctgggtcatacatgtggatatatgc26
BBa_K3464002Reverse Primer for the detection of the rs4149056agcaaaggactattgaaagagtgaat26