DNA/Primer binding sites
 |
Primer binding sites are DNA sequences specifically designed for oligo annealing. For example, most BioBrick plasmid backbones include binding sites for the VF2 and VR primers. |
 |
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_G00000 | BioBrick cloning site prefix | gaattcgcggccgcttctagag | 22 |
| BBa_G00001 | BioBrick cloning site suffix | tactagtagcggccgctgcag | 21 |
| BBa_G00100 | Forward primer for sequencing/amplifying BioBrick parts (VF2) | tgccacctgacgtctaagaa | 20 |
| BBa_G00102 | Reverse BioBrick primer annealing site (VR binding site) | gctcactcaaaggcggtaat | 20 |
| BBa_K3464000 | Forward Primer for the detection of ancestral allele of the rs4149056 | tctgggtcatacatgtggatatatgt | 26 |
| BBa_K3464001 | Forward Primer for the detection of alternative allele of the rs4149056 | tctgggtcatacatgtggatatatgc | 26 |
| BBa_K3464002 | Reverse Primer for the detection of the rs4149056 | agcaaaggactattgaaagagtgaat | 26 |
| BBa_K4816001 | napA primer forward | cagtcacatatgatgaccatctcgcggc | 28 |