Assembly standard 15
(Redirected from BioScaffold standard)
Bioscaffold sites are BioBrick parts that contain restriction enzyme recognition sites that enable full or partial removal of the Bioscaffold site from a composite BioBrick part. Bioscaffold parts address some of the limitations of BioBrick standard assembly by enabling protein fusions, cloning of part libraries within a composite BioBrick part, and removal of BioBrick scars.
| Help: Want to know more about Assembly standard 15 (the BioScaffold standard)? See the help pages for more information. |
| Name | Description | Sequence | Length |
|---|---|---|---|
| BBa_J70010 | A BioScaffold Part (Uses PpiI), for offset see Part Design page | . . . taattaattaaacctggtgaacgtggtctc | 53 |
| BBa_J70012 | A BioScaffold Part (Uses PsrI), Protein Head Remover see Part Design page | . . . gcgccggcgcgccagctggtgaacaccagg | 52 |
| BBa_J70030 | A BioScaffold Part (Uses PpiI), Protein Tail Remover see Part Design Page | . . . taattaattaaaccaggtgaacgtggtctc | 48 |
| BBa_J70032 | A Composite BioScaffold Part (PpiI and PsrI) for Protein Fusions (see Design Page) | . . . gcgccggcgcgccagctggtgaacaccagg | 138 |
| BBa_J70034 | A BioScaffold Part (Uses AarI) for Library Vector Preparation (see Part Design page) | . . . gagtcccgggagctggaactcccacctgca | 45 |
| BBa_J70036 | A BioScaffold Part (Uses AarI) for Library Insert Preparation (see Part Design page) | . . . tcccgggagctggaactcccacctgcatat | 51 |
| BBa_J70040 | A BioScaffold Part (Uses AarI, MabI) for Library Vector Preparation (see Part Design page) | . . . gggtcccgggagcaccaggtcccacctgca | 45 |
| BBa_J70050 | Left Library Insert Preparation Part (To use with J70052, and J70040) | cacctgcatat | 11 |
| BBa_J70052 | Right Library Insert Preparation Part (To use with J70050, and J70040) | atagcaggtg | 10 |
| BBa_K259002 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ctagctcctcagtggcagcggtgaggaggc | 88 |
| BBa_K259004 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . tatgtaagtagtaacaagtagcgtggggca | 81 |
| BBa_K259008 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . ggtatgtaagtagtacaagtagcgtggggc | 79 |
| BBa_K259009 | BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker | . . . atgtaagtagtaacaagtagcgtggggcag | 82 |
| BBa_K606026 | tetO Array | . . . tctatcactgatagggacccccaactctgt | 3628 |
 |
Julie Norville, as a graduate student in Tom Knight and Angie Belcher's lab at MIT, developed a new set of DNA parts called Bioscaffold sites. Bioscaffold sites can be assembled as regular BioBrick parts, but enable you to remove BioBrick scars, create protein fusions, and insert part libraries within composite parts. |
References
- [http://openwetware.org/wiki/The_BioBricks_Foundation:BBFRFC15 BioBricks Foundation RFC 15] by Julie Norville, Angie Belcher and Tom Knight