Promoters/Catalog/Madras
Description
Members of the Stress Kit promoter collection are LacI repressible promoters that have been engineered to use two of the stress response σ factors (σ24, σ28, σ32, and σ38) from E. coli. The promoters are based on the LacO promoter designed by Lutz and Bujard, which contains two LacI binding sites, and σ70 boxes. Using published experimental and bioinformatics data, we generated 'hybrid' promoters in which the σ70 boxes were partially replaced with alternative σ boxes, with minimal disruption to the LacI binding sites. In this manner, four hybrid promoters were designed for each alternative σ factor. This collection was developed by the 2008 IIT Madras team.
Obtaining the StressKit promoter collection
The sequences of the Stress Kit promoters can be found via the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the promoters are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligo's and annealed. See here for a tutorial on how to construct short parts via oligo annealing.
Via the Registry distribution: The promoters will be available in the 2009 Registry distribution.
The StressKit promoter collection
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K086017 | unmodified Lutz-Bujard LacO promoter | . . . ttgtgagcggataacaagatactgagcaca | 55 | 1209 | In stock | ||
| BBa_K086018 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 | . . . ttgtgagcggataacaattctgaagaacaa | 55 | 1286 | Not in stock | ||
| BBa_K086019 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 | . . . ttgtgagcggataacaattctgataaaaca | 55 | 1287 | Not in stock | ||
| BBa_K086020 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 | . . . ttgtgagcggataacatctaaccctttaga | 55 | 1288 | Not in stock | ||
| BBa_K086021 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ24 | . . . ttgtgagcggataacatagcagataagaaa | 55 | 1288 | Not in stock | ||
| BBa_K086022 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 | . . . gtttgagcgagtaacgccgaaaatcttgca | 55 | 1282 | Not in stock | ||
| BBa_K086023 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 | . . . gtgtgagcgagtaacgacgaaaatcttgca | 55 | 1295 | Not in stock | ||
| BBa_K086024 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 | . . . tttgagcgagtaacagccgaaaatcttgca | 55 | 1295 | Not in stock | ||
| BBa_K086025 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ28 | . . . tgtgagcgagtaacagccgaaaatcttgca | 55 | 1295 | Not in stock | ||
| BBa_K086026 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtggcaccattaagtacgta | 55 | 1294 | Not in stock | ||
| BBa_K086027 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtgacaccattaagtacgta | 55 | 1294 | Not in stock | ||
| BBa_K086028 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtaacaccattaagtacgta | 55 | 1294 | Not in stock | ||
| BBa_K086029 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ32 | . . . ttgtgagcgagtaacaccattaagtacgta | 55 | 1294 | Not in stock | ||
| BBa_K086030 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . cagtgagcgagtaacaactacgctgtttta | 55 | 1294 | Not in stock | ||
| BBa_K086031 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . cagtgagcgagtaacaactacgctgtttta | 55 | 1296 | Not in stock | ||
| BBa_K086032 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . atgtgagcggataacactataattaataga | 55 | 1294 | Not in stock | ||
| BBa_K086033 | modified Lutz-Bujard LacO promoter,with alternative sigma factor σ38 | . . . atgtgagcggataacactataattaataga | 55 | 1294 | Not in stock |
Characterization
Contributors
The Stresskit was developed by the IIT Madras iGEM team from 2008.