Promoters/Catalog/Eukaryotic/Multiple
This page lists eukaryotic promoters that are Multi-regulated meaning that each promoter is either positively or negatively regulated by multiple transcription factors (other than the sigma factor). For example, a promoter negatively regulated by two repressor proteins forms the basis of a nor gate, the presence of either or both repressors is sufficient to produce a low output from the promoter. These promoters are useful if, for example, you are looking to build logic gates, or if you are looking to build a system where expression of a gene must be dependent on multiple environmental factors. Note that constitutive yeast promoters have their own page.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_J05215 | Regulator for R1-CREBH | . . . ggggcgagggccccgcctccggaggcgggg | 41 | 1188 | Not in stock | ||
| BBa_J05216 | Regulator for R3-ATF6 | . . . gaggggacggctccggccccggggccggag | 41 | 1189 | Not in stock | ||
| BBa_J05217 | Regulator for R2-YAP7 | . . . ggggcgagggctccggccccggggccggag | 41 | 1188 | Not in stock | ||
| BBa_J05218 | Regulator for R4-cMaf | . . . gaggggacggccccgcctccggaggcgggg | 41 | 1189 | Not in stock |