Difference between revisions of "Part:BBa K305011:Design"
(→Design Notes) |
(→Design Notes) |
||
(5 intermediate revisions by the same user not shown) | |||
Line 11: | Line 11: | ||
− | Cloning with this plasmid in certain E. coli strains (MC1061 and TOP10) results in the insertion of an IS element of around 800bp containing a PstI site. | + | Cloning with this plasmid in certain E. coli strains (MC1061 and TOP10) results in the insertion of an IS element of around 800bp containing a PstI site. It can be detected by a PstI restriction, yielding two fragments of 2783 and 1161bp's, or by a PCR using the following primers, producing a 525, or 1301bp product. Forward: ATTGAGAGGAGGGATTATTG, reverse:GAGTTTATCACCCTTGTC. Cloning in ''Bacillus subtilis'' or ''Lactococcus lactis'' is recomended. |
===Source=== | ===Source=== | ||
− | + | Bongers ''et al'', 2005 | |
===References=== | ===References=== | ||
+ | |||
+ | <biblio> | ||
+ | #Bongers pmid=16332878 | ||
+ | </biblio> |
Latest revision as of 16:07, 28 October 2010
Subtilin inducible expression plasmid for Bacillus subtilis
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 3141
Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9
Illegal NotI site found at 3147 - 21INCOMPATIBLE WITH RFC[21]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal EcoRI site found at 3141
Illegal BglII site found at 3060
Illegal XhoI site found at 287 - 23INCOMPATIBLE WITH RFC[23]Illegal prefix found at 3141
Illegal suffix found at 2 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found at 3141
Plasmid lacks a suffix.
Illegal XbaI site found at 3156
Illegal SpeI site found at 2
Illegal PstI site found at 16 - 1000INCOMPATIBLE WITH RFC[1000]Plasmid lacks a prefix.
Plasmid lacks a suffix.
Illegal SapI site found at 324
Design Notes
Contains a BamHI restriction site in between the prefix and suffix.
Cloning with this plasmid in certain E. coli strains (MC1061 and TOP10) results in the insertion of an IS element of around 800bp containing a PstI site. It can be detected by a PstI restriction, yielding two fragments of 2783 and 1161bp's, or by a PCR using the following primers, producing a 525, or 1301bp product. Forward: ATTGAGAGGAGGGATTATTG, reverse:GAGTTTATCACCCTTGTC. Cloning in Bacillus subtilis or Lactococcus lactis is recomended.
Source
Bongers et al, 2005
References
<biblio>
- Bongers pmid=16332878
</biblio>