Difference between revisions of "Part:BBa K3013001"

Latest revision as of 14:03, 18 October 2019

TA2, polymer binding peptide

TA2 (Tachystatin A2) is a binding peptide for polystyrene and polypropylene. It can be used to functionalize or tag polymers with proteins fused to the c-terminus of TA2.

Usage and Biology

To characterize the binding function of TA2 we used a fusion of eGFP with TA2. This construct also contaied a linker (17x Helix: GCAGAAGCAGCAGCAAAAGAAGCCGCTGCCAAAGAAGCGGCAGCGAAAGCA) to allow correct folding of the construct and a cleavage site for TEV protease (GAAAATCTGTATTTTCAGGGT). The construct eGFP-17xhelix-TEV-TA2 and eGFP without binding peptide was cloned in the expression vector pET28a(+) and transformed in chemically competent E. coli BL21 [Sambrook J, Fritsch EF, and Maniatis T (1989), Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.]. Proteins were expressed as shown in the following protocol.

Protein expression
Make overnight culture as preculture in 4 mL LB-Kan at 37 °C
Inoculate main culture with 1:100 preculture
Let main culture grow at 37 °C on shaker (250 rpm)
Induce main culture at OD(600) of 0,6 – 0,7 with 0,1 mM IPTG (final concentration)
Express proteins for 40 h at 20 °C on shaker (250 rpm)
Harvest cells by centrifugation (10 min, 4 °C, 4000 rpm)
Discard supernatant and suspend pellet in 5 mL TRIS-HCl (pH: 8,0) by vortexing or store pellet at -20°C
Disrupt cells by sonification (pulse: 3x 30 s with 30 s pause, amplitude: 70 %) on ice
Centrifuge disrupted cells for 15 min, 4 °C, 4000 rpm
Filter supernatant through 0,45 μm sterile filter
Store protein fraction at -20 °C or for short durations at 4 °C

The soluble protein fraction was used for binding tests without further purification. Also E. coli BL21 without any plasmid was treated the same as a negative control. Binding tests were performed in PS and PP microtiter plates (MTP). For each sample (empty BL21 soluble protein fraction, eGFP and eGFP-17xhelix-TEV-TA2) 24 wells were used. Each well was filled with 5 μL filtered supernatant and 95 μL TRIS-HCl (pH: 8,0). Fluorescence was measured in TECAN reader M1000. Gain and z-position was calculated from wells containing eGFP-TA2. Measurement was done with an excitation wavelength of 485 nm, an emission wavelength of 520 nm, 50 reads per well and a circle in each well of 2x2 points of measurement.
Plates were incubated for 10 min at 600 rpm (at room temperature). All wells were washed two times with 100 μL TRIS-HCl (pH: 8,0), incubated for 5 min (600 rpm, room temperature) and the fluid was discarded after each step. The residual fluorescence was measured again as described above with calculated gain and again with the gain calculated before washing. The gain sets the strength of the signal got from the emission of eGFP.
A diagram of the fluorescence on a PP and PS MTP before and after washing with the same gain of 121 is shown in below (figure 1 - 4).

Binding to PP (polypropylene) of TA2

• 

  Figure 1: Before washing PP binding essay before washing. Fluorescence measurement of binding of eGFP-TA2 to a polypropylene microtiter plate. eGFP is a reference and BL21 a negative control. Gain is 121.

• 

  Figure 2: After washing PP binding essay after washing two times. Fluorescence measurement of binding of eGFP-TA2 to a polypropylene microtiter plate. eGFP is a reference and BL21 a negative control. Gain is 121.

Binding to PS (polystyrene) of TA2

• 

  Figure 3: Before washing PP binding essay before washing. Fluorescence measurement of binding of eGFP-TA2 to a polypropylene microtiter plate. eGFP is a reference and BL21 a negative control. Gain is 121.

• 

  Figure 4: After washing PS binding essay after washing two times. Fluorescence measurement of binding of eGFP-TA2 to a polypropylene microtiter plate. eGFP is a reference and BL21 a negative control. Gain is 121.

As shown in Figure 1 – 4, TA2 binds to PP and PS, while binding to PP seems to be stronger.
The fluorescence of eGFP alone was the strongest in our purified protein fractions but after the washing its fluorescence is nearly gone, indicating that adsorption of eGFP to either PS or PP is low. Furthermore, there is no significant background fluorescence from the soluble protein fraction of E. coli BL21 as its fluorescence remains low before and after washing.

For a stronger binding peptide see also BBa_K3013000.

Sequence and Features