Difference between revisions of "Part:BBa K1789001"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1789001 short</partinfo>
 
<partinfo>BBa_K1789001 short</partinfo>
Line 5: Line 4:
 
This part is the coding sequence of the enzyme Indoleacetimide hydrolase Iaa H. This enzyme catalyses the hydrolysis of indoleacetamide to indoleacetate and ammonia. This part is gathered from the 2-step pathway in Pseudomonas savastanoi producing the auxin, indole-3-acetic acid.
 
This part is the coding sequence of the enzyme Indoleacetimide hydrolase Iaa H. This enzyme catalyses the hydrolysis of indoleacetamide to indoleacetate and ammonia. This part is gathered from the 2-step pathway in Pseudomonas savastanoi producing the auxin, indole-3-acetic acid.
  
−
<!-- Add more about the biology of this part here
+
==Usage and Biology==
−
===Usage and Biology===
+
Indole-3-acetic acid (IAA), also known as auxin, is a plant hormone, which can promote growth and protect the soil from erosion. IAA can be synthesized through IAM pathway, originated from ''Pseudomonas savastanoi''. Two important enzymes are contained in this pathway, AKA IaaM and IaaH.
  
 +
[[File:IaaPathway.jpg]]
 +
 +
IaaM is the tryptophan-2-mono-oxygenase. This enzyme catalyzes the oxidative carboxylation of L-tryptophan to indole-3-acetamide. IaaH is the indoleacetimide hydrolase. This enzyme catalyses the hydrolysis of indoleacetamide to indoleacetate and ammonia. This pathway is relevantly easy to be expressed in prokaryotic cells, and its substrate (Trp) can be synthesized by host cells.
 +
 +
==Sequence and Features==
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
Line 16: Line 20:
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K1789001 parameters</partinfo>
 
<partinfo>BBa_K1789001 parameters</partinfo>
 +
<!-- -->
 +
 +
==Experimental Validation==
 +
 +
This part is validated through three ways: enzyme cutting, PCR, Sequence, and functional testing
 +
 +
===PCR===
 +
 +
'''Methods'''
 +
 +
The PCR is performed with Premix EX Taq by Takara.
 +
 +
F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGCGCGAAATG -3’
 +
 +
R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’
 +
 +
The PCR protocol is selected based on the Users Manuel.
 +
The Electrophoresis was performed on a 1％ Agarose glu.
 +
 +
'''Results'''
 +
 +
 +
 +
The result of the agarose electrophoresis was shown on the picture above.
 +
 +
 +
===Enzyme cutting===
 +
 +
'''Methods'''
 +
 +
After the assembly ,the plasmid was transferred into the Competent ''E. coli'' DH5α). After culturing overnight in LB,we minipreped the plasmid for cutting.
 +
The preparation of the plasmid was performed with TIANprep Mini Plasmid Kit from ''TIANGEN''. The cutting procedure was performed with EcoRI and XbaI restriction endonuclease bought from ''TAKARA''.
 +
 +
The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours.
 +
The Electrophoresis was performed on a 1％ Agarose glu.
 +
 +
'''Results'''
 +
 +
 +
 +
The result of the agarose electrophoresis was shown on the picture above.
 +
 +
 +
 +
===Functional Test===
 +
 +
This part is tested together with the part BBa_K1789000, in the device BBa_K1789022.
 +
 +
'''The result shows that this part can work as expected to generate IAA together with IAAM.'''
 +
 +
<partinfo>BBa_K1789000 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Revision as of 11:32, 18 September 2015

IaaH

This part is the coding sequence of the enzyme Indoleacetimide hydrolase Iaa H. This enzyme catalyses the hydrolysis of indoleacetamide to indoleacetate and ammonia. This part is gathered from the 2-step pathway in Pseudomonas savastanoi producing the auxin, indole-3-acetic acid.

Usage and Biology

Indole-3-acetic acid (IAA), also known as auxin, is a plant hormone, which can promote growth and protect the soil from erosion. IAA can be synthesized through IAM pathway, originated from Pseudomonas savastanoi. Two important enzymes are contained in this pathway, AKA IaaM and IaaH.

IaaPathway.jpg

IaaM is the tryptophan-2-mono-oxygenase. This enzyme catalyzes the oxidative carboxylation of L-tryptophan to indole-3-acetamide. IaaH is the indoleacetimide hydrolase. This enzyme catalyses the hydrolysis of indoleacetamide to indoleacetate and ammonia. This pathway is relevantly easy to be expressed in prokaryotic cells, and its substrate (Trp) can be synthesized by host cells.

Sequence and Features

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1005
  • 1000
    COMPATIBLE WITH RFC[1000]


Experimental Validation

This part is validated through three ways: enzyme cutting, PCR, Sequence, and functional testing

PCR

Methods

The PCR is performed with Premix EX Taq by Takara.

F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGCGCGAAATG -3’

R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’

The PCR protocol is selected based on the Users Manuel. The Electrophoresis was performed on a 1％ Agarose glu.

Results


The result of the agarose electrophoresis was shown on the picture above.


Enzyme cutting

Methods

After the assembly ,the plasmid was transferred into the Competent E. coli DH5α). After culturing overnight in LB,we minipreped the plasmid for cutting. The preparation of the plasmid was performed with TIANprep Mini Plasmid Kit from TIANGEN. The cutting procedure was performed with EcoRI and XbaI restriction endonuclease bought from TAKARA.

The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours. The Electrophoresis was performed on a 1％ Agarose glu.

Results


The result of the agarose electrophoresis was shown on the picture above.


Functional Test

This part is tested together with the part BBa_K1789000, in the device BBa_K1789022.

The result shows that this part can work as expected to generate IAA together with IAAM.