Difference between revisions of "Part:BBa K1680016:Design"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1680016 short</partinfo>
 
<partinfo>BBa_K1680016 short</partinfo>
Line 7: Line 6:
  
 
===Design Notes===
 
===Design Notes===
−
Has an RFC10 compatible MCS, with ADH Terminator. No further RFC10 restrictions sites in the backbone.
 
  
 +
This part is derived from the pRS316 vector (Sikorski 1989). It is mutagenised to be compatible with RFC10 and the wild type MCS was switched for a RFC10 MCS. The biobrick MCS is flanked by ''Apa''I (Prefix) and ''Sac''I (Suffix) restriction sites. These can be used together with either ''Eco''RI or ''Pst''I site to introduce a promoter or terminator stably into the vector without disturbing the RFC10 standard.
  
 +
 +
Sequence of the new RFC10 MCS:
 +
 +
GGGCCCACGTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGACGTGAGCTC
  
 
===Source===
 
===Source===
  
−
yeast shuttle vector
+
Derived from pRS316 (Sikorski 1989).
 +
 
  
 
===References===
 
===References===
 +
 +
Sikorski, Robert S., and Philip Hieter. "A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae." Genetics 122.1 (1989): 19-27.

Revision as of 01:14, 26 September 2015

pRS316 yeast shuttle vector with Biobrick MCS


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2040
    Illegal XbaI site found at 2025
    Illegal SpeI site found at 2017
    Illegal PstI site found at 2003
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2040
    Illegal SpeI site found at 2017
    Illegal PstI site found at 2003
    Illegal NotI site found at 2008
    Illegal NotI site found at 2032
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2040
  • 23
    INCOMPATIBLE WITH RFC[23]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2040
    Illegal XbaI site found at 2025
    Illegal SpeI site found at 2017
    Illegal PstI site found at 2003
  • 25
    INCOMPATIBLE WITH RFC[25]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 2040
    Illegal XbaI site found at 2025
    Illegal SpeI site found at 2017
    Illegal PstI site found at 2003
    Illegal NgoMIV site found at 1668
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal BsaI site found at 1079
    Illegal BsaI.rc site found at 3414
    Illegal SapI site found at 2331
    Illegal SapI site found at 4435
    Illegal SapI.rc site found at 926


Design Notes

This part is derived from the pRS316 vector (Sikorski 1989). It is mutagenised to be compatible with RFC10 and the wild type MCS was switched for a RFC10 MCS. The biobrick MCS is flanked by ApaI (Prefix) and SacI (Suffix) restriction sites. These can be used together with either EcoRI or PstI site to introduce a promoter or terminator stably into the vector without disturbing the RFC10 standard.


Sequence of the new RFC10 MCS:

GGGCCCACGTGAATTCGCGGCCGCTTCTAGAGTACTAGTAGCGGCCGCTGCAGACGTGAGCTC

Source

Derived from pRS316 (Sikorski 1989).


References

Sikorski, Robert S., and Philip Hieter. "A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae." Genetics 122.1 (1989): 19-27.