J100465

Part number: J100465 Sequence: pCloneRed_Thurs_AM_Yellow_Top: 5'-CGACAGTTTTTGACACTTTCATAACACCAAGCAACTAATATATAATCTATAACATACAA

pCloneRed_Thurs_AM_Yellow_Bottom: 5'-CCGCTTGTATGTTATAGATTATATATTAGTTGCTTGGTGTTATGAAAGTGTCAAAAACT The promoter elements included in this experiment were both the eukaryotic TATA box and the prokaryotic –10 to –35 regions. The behavior of these elements should promote transcription, as each element is found in the core promoter regions of either eukaryotes or prokaryotes. Having created a hybrid between the eukaryotic and prokaryotic elements, we are looking to enhance the transcription and function of the hybrid promoter, which has been tested in prokaryotes. To compare RFP production, we measured the mean fluorescence normalized to an optical density at 590nm, in which be observed a significant increase in RFP production in our promoter compared to both the negative control and positive control. The experimental values being significantly larger than those of the positive control indicates greater function of the promoter due to these added prokaryotic elements.

Experiment #1: We compared RFP production, as a measure of mean fluorescence (excitation at 588 nm and emission at 532 nm) normalized to OD at 600 nm, in our J100448 promoter in technical triplicates to RFP production in a positive control (J04450), which is a known E. coli promoter, and a negative control (J119137), which was the unmodified promoter. We observed a significant increase in RFP production in our promoter compared to the negative control. However, these values were significantly less than the positive control. We confirmed using PCR that the inserts were properly cloned.

Figure 1: Graph of mean fluorescence/optical density ratio (at 590nm) for experiment 1.

Figure 2. Graph of mean fluorescence normalized to optical density (measured at 590 nm).