Part:BBa_K5237000
fgRNA Entry Vector MbCas12a-SpCas9
This part integrates the crRNA of MbCas12a (BBa_K5237206) and the sgRNA of SpCas9 (BBa_K5237209) into a single
fusion
guide RNA (fgRNA). This fgRNA was functionally validated (see detailed characterization data below), meaning that the MbCas12a (BBa_K5237001),
SpCas9 (BBa_K5237002) and the fusion dCas (BBa_K5237003)
can both utilize the fgRNA to target/bind two different genomic loci simultaneously. The fgRNA also works in combination
with the catalytically inactive dCas9 and dCas12a
versions, facilitating DNA-DNA stapling and hence 3D genome engineering in eukaryotes.
Employing the fgRNA design described here, we successfully showed genome editing at two different loci in human cells simultaneously using active SpCas9 and Cas12a. Furthermore, the fgRNA enabled inducing proximity of two genomic loci with the catalytically inactive dSpCas9 and dMbCas12a.
For our part collection, the PICasSO toolbox, part BBa K5237000 is the central core component, since it enables to the
creation and programming of our CRISPR/Cas staples - trimeric complexes comprised of a fgRNA, dCas9 and dCas12a employed
for tethering two distinct genomic loci for 3D genome engineering.
Â
Contents
While synthetic biology has in the past focused on engineering the genomic sequence of organisms, the 3D
spatial organization of DNA is well-known to be an important layer of information encoding in
particular in eukaryotes, playing a crucial role in
gene regulation and hence
cell fate, disease development, evolution, and more. However, tools to precisely manipulate and control the
genomic spatial
architecture are limited, hampering the exploration of
3D genome engineering in synthetic biology. We - the iGEM Team Heidelberg 2024 - have developed PICasSO, a
powerful
molecular toolbox for rationally engineering genome 3D architectures in living cells, based on
various DNA-binding proteins.
The PICasSO part collection offers a comprehensive, modular platform for precise manipulation and re-programming of DNA-DNA interactions using engineered "protein staples" in living cells. This enables researchers to recreate naturally occurring alterations of 3D genomic interactions, such as enhancer hijacking in cancer, or to design entirely new spatial architectures for artificial gene regulation and cell function control. Specifically, the fusion of two DNA binding proteins enables to artificially bring otherwise distant genomic loci into spatial proximity. To unlock the system's full potential, we introduce versatile chimeric CRISPR/Cas complexes, connected either at the protein or - in the case of CRISPR/Cas-based DNA binding moieties - the guide RNA level. These complexes are referred to as protein- or Cas staples, respectively. Beyond its versatility with regard to the staple constructs themselves, PICasSO includes robust assay systems to support the engineering, optimization, and testing of new staples in vitro and in vivo. Notably, the PICasSO toolbox was developed in a design-build-test-learn engineering cycle closely intertwining wet lab experiments and computational modeling and iterated several times, yielding a collection of well-functioning and -characterized parts.
At its heart, the PICasSO part collection consists of three categories.
(i) Our DNA-binding
proteins
include our
finalized Cas staple experimentally validated using an artificial "enhancer hijacking" system as well as
"half staples" that can be combined by scientists to compose entirely
new Cas staples in the future. We also include our Simple staples comprised of particularly small, simple
and robust DNA binding domains well-known to the synthetic biology community, which serve as controls for
successful stapling
and can be further engineered to create alternative, simpler, and more compact staples.
(ii) As functional elements, we list additional parts that enhance and expand the
functionality of our Cas and
Basic staples. These
consist of staples dependent on
cleavable peptide linkers targeted by cancer-specific proteases or inteins that allow condition-specific,
dynamic stapling in vivo.
We also include several engineered parts that enable the efficient delivery of PICasSO's constructs into
target cells, including mammalian cells,
with our new
interkingdom conjugation system.
(iii) As the final category of our collection, we provide parts that underlie our custom
readout
systems. These include components of our established FRET-based proximity assay system, enabling
users to
confirm
accurate stapling. Additionally, we offer a complementary, application-oriented testing system based on a
luciferase reporter, which allows for straightforward experimental assessment of functional enhancer
hijacking events
in mammalian cells.
The following table gives a comprehensive overview of all parts in our PICasSO toolbox. The highlighted parts showed
exceptional performance as described on our iGEM wiki and can serve as a reference. The other
parts in
the
collection are versatile building blocks designed to provide future iGEMers with the flexibility to engineer
their
own custom Cas staples, enabling further optimization and innovation in the new field of 3D genome
engineering.
Our part collection includes:
| DNA-Binding Proteins: Modular building blocks for engineering of custom staples to mediate defined DNA-DNA interactions in vivo | ||
| BBa_K5237000 | Fusion Guide RNA Entry Vector MbCas12a-SpCas9 | Entry vector for simple fgRNA cloning via SapI |
| BBa_K5237001 | Staple Subunit: dMbCas12a-Nucleoplasmin NLS | Staple subunit that can be combined with crRNA or fgRNA and dSpCas9 to form a functional staple |
| BBa_K5237002 | Staple Subunit: SV40 NLS-dSpCas9-SV40 NLS | Staple subunit that can be combined with a sgRNA or fgRNA and dMbCas12a to form a functional staple |
| BBa_K5237003 | Cas Staple: SV40 NLS-dMbCas12a-dSpCas9-Nucleoplasmin NLS | Functional Cas staple that can be combined with sgRNA and crRNA or fgRNA to bring two DNA strands into close proximity |
| BBa_K5237004 | Staple Subunit: Oct1-DBD | Staple subunit that can be combined to form a functional staple, for example with TetR. Can also be combined with a fluorescent protein as part of the FRET proximity assay |
| BBa_K5237005 | Staple Subunit: TetR | Staple subunit that can be combined to form a functional staple, for example with Oct1. Can also be combined with a fluorescent protein as part of the FRET proximity assay |
| BBa_K5237006 | Simple Staple: TetR-Oct1 | Functional staple that can be used to bring two DNA strands in close proximity |
| BBa_K5237007 | Staple Subunit: GCN4 | Staple subunit that can be combined to form a functional staple, for example with rGCN4 |
| BBa_K5237008 | Staple Subunit: rGCN4 | Staple subunit that can be combined to form a functional staple, for example with rGCN4 |
| BBa_K5237009 | Mini Staple: bGCN4 | Assembled staple with minimal size that can be further engineered | Functional Elements: Protease-cleavable peptide linkers and inteins are used to control and modify staples for further optimization for custom applications |
| BBa_K5237010 | Cathepsin B-cleavable Linker: GFLG | Cathepsin B-cleavable peptide linker that can be used to combine two staple subunits to make responsive staples |
| BBa_K5237011 | Cathepsin B Expression Cassette | Expression cassette for the overexpression of cathepsin B |
| BBa_K5237012 | Caged NpuN Intein | A caged NpuN split intein fragment that undergoes protein trans-splicing after protease activation, which can be used to create functionalized staple subunits |
| BBa_K5237013 | Caged NpuC Intein | A caged NpuC split intein fragment that undergoes protein trans-splicing after protease activation, which can be used to create functionalized staple subunits |
| BBa_K5237014 | Fusion Guide RNA Processing Casette | Processing cassette to produce multiple fgRNAs from one transcript, that can be used for multiplexed 3D genome reprogramming |
| BBa_K5237015 | Intimin anti-EGFR Nanobody | Interkingdom conjugation between bacteria and mammalian cells, as an alternative delivery tool for large constructs |
| BBa_K4643003 | IncP Origin of Transfer | Origin of transfer that can be cloned into the plasmid vector and used for conjugation as a means of delivery | Readout Systems: FRET and enhancer recruitment readout systems to rapidly assess successful DNA stapling in bacterial and mammalian cells |
| BBa_K5237016 | FRET-Donor: mNeonGreen-Oct1 | FRET donor-fluorophore fused to Oct1-DBD that binds to the Oct1 binding cassette, which can be used to visualize DNA-DNA proximity |
| BBa_K5237017 | FRET-Acceptor: TetR-mScarlet-I | Acceptor part for the FRET assay binding the TetR binding cassette, which can be used to visualize DNA-DNA proximity |
| BBa_K5237018 | Oct1 Binding Casette | DNA sequence containing 12 Oct1 binding motifs, compatible with various assays such as the FRET proximity assay |
| BBa_K5237019 | TetR Binding Cassette | DNA sequence containing 12 Oct1 binding motifs, can be used for different assays such as the FRET proximity assay | BBa_K5237020 | Cathepsin B-Cleavable Trans-Activator: NLS-Gal4-GFLG-VP64 | Readout system that responds to protease activity, which was used to test cathepsin B-cleavable linker |
| BBa_K5237021 | NLS-Gal4-VP64 | Trans-activating enhancer, that can be used to simulate enhancer hijacking | BBa_K5237022 | mCherry Expression Cassette: UAS, minimal Promoter, mCherry | Readout system for enhancer binding, which was used to test cathepsin B-cleavable linker |
| BBa_K5237023 | Oct1 - 5x UAS Binding Casette | Oct1 and UAS binding cassette, that was used for the simulated enhancer hijacking assay |
| BBa_K5237024 | TRE-minimal Promoter- Firefly Luciferase | Contains firefly luciferase controlled by a minimal promoter, which was used as a luminescence readout for simulated enhancer hijacking |
1. Sequence overview
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 339
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 571
Illegal SapI site found at 662
Illegal SapI.rc site found at 280
2. Usage and Biology
2.1 Discovery and Mechanism of CRISPR/Cas9
In 2012, Jinek et al. discovered the use of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas system to induce double-strand breaks in DNA in a programmable manner. Since then, the system has been well established as a tool for genome editing. The CRISPR/Cas system, which originates from the bacterial immune system, is constituted by a ribonucleoprotein complex. For class 1 CRISPR systems, an RNA guide is complexed by multiple Cas proteins, whereas class 2 systems consist of a singular protein binding RNA. The class 2 type II system describes all ribonucleoprotein complexes with Cas9 (Pacesa et al., 2024). They include a CRISPR RNA (crRNA), which specifies the target sequence with a ~20 nucleotide (nt) spacer sequence, and a transactivating CRISPR RNA (tracrRNA), which induces the processing by the Cas protein (Jinek et al., 2012) (Fig. 2 A). Furthermore, a specific three nucleotide sequence (NGG) at the 3' end in the targeted DNA is needed for Cas9 DNA binding and cleavage. This is referred to as the protospacer adjacent motif (PAM) (Sternberg et al., 2014). The most commonly used Cas9 protein is SpCas9 or SpyCas9, which originates from Streptococcus pyogenes (Pacesa et al., 2024).
A significant enhancement of the CRISPR/Cas9 system was the introduction of single guide RNAs (sgRNA[s]), which combine the functions of a tracrRNA and crRNA (Jinek et al., 2012; Mali et al., 2013). Moreover, Cong et al. (2013) established precise targeting of human endogenous loci by designing the 20 nt spacer sequence accordingly.
2.2 Differences between Cas9 and Cas12a
Over the following years, several additional class 2 CRISPR/Cas systems have been discovered, including the Cpf1 system, which has been classified as Cas12a since then (Zetsche et al., 2015). Cas12a forms a class 2 type V system. In contrast to the type II systems, the Cas12a RNA guide only requires a crRNA to mediate Cas12a DNA targeting. Moreover, Cas12a is capable of processing long precursor crRNA transcripts into several, single/independent crRNAs, whereas Cas9 requires the RNase III enzyme and tracrRNA for this process (Paul and Montoya, 2020). This crRNA is often also referred to as a guide RNA (gRNA). However, the stem loop that is formed when binding the Cas protein is structurally distinct to the Cas9 gRNA and positioned on the 5' side of the crRNA (Fig. 2 B). Similarly, the PAM (TTTV) is also on the 5' side (Pacesa et al., 2024). Cas9 possesses RuvC and HNH domains that are catalytically active, each of which cleaves one of the DNA strands at the same site, resulting in the formation of blunt end cuts (Nishimasu et al., 2014). Cas12a possesses one RuvC-like domain that creates staggered cuts with overhangs that are about 5nt long (Paul and Montoya, 2020).
2.3 Dead Cas Proteins and their Application
Specific mutations of these domains result in catalytic inactivity and therefore allow for the creation of nickases that only cut one of the DNA strands, or Cas protein mutants that retain their DNA binding capability, but have no catalytic activity (Koonin et al., 2023) (Kleinstiver et al., 2019). The latter are referred to as dead Cas proteins or dCas9 and dCas12a. These Cas proteins can be used to activate (CRISPRa) or inhibit (CRISPRi) the expression of genes by fusing them to effector domains and targeting the respective genes via complementary spacer sequences (Kampmann, 2017). A common approach for CRISPRa involves fusing Cas9 with the transcriptional activator, such as VP64 or VPR (Kampmann, 2017).
3. Assembly and Part Evolution
Building on insights of our fusion Cas engineering cycle and findings from Kweon (2017), fgRNAs were
designed by
combining the sgRNA from SpCas9 with the crRNA from MbCas12a. Specifically the 3'-end of the MbCas12a gRNA
was
linked to the 5'-end of the SpCas9 gRNA (through genetic fusion). Via this approach, the two spacer
sequences are fused directly, ensuring a
minimal distance between the two DNA strands to be co-bound by the Cas staple complex. This also facilitates
efficient cloning of different spacer
sequences, as both spacers can be obtained as one consecutive sequence encoded on a single oligo. Linking
the crRNA and sgRNA further enables
multiplexing, as Cas12a can inherently process crRNA repeats that are expressed from one single transcript,
enabling multiplexing. The entry vector includes a U6 promoter, the
MbCas12a scaffold, a bacterial promoter driving ccdB expression, and the SpCas9 scaffold. Successful
spacer
integration leads to the removal of the ccdB gene, allowing bacterial growth to be used as an
indicator for
cloning success.
A conventional gRNA expression vector containing an MbCas12a crRNA scaffold under the control of an U6
promoter was selected as the basis
for entry vector cloning. The vector and a ccdB-SpCas9 scaffold construct were PCR amplified and fitting
overhangs
for SapI were introduced (Fig. 3). Golden Gate assembly (GGA) with Esp3I was used to create the final
plasmid. The
transformation was carried out in the ccdB-resistant XL1 Blue E. Coli strain.
The first goal following successful assembly of our first fgRNAs was to show the simultaneous editing of the two fgRNA-targeted genomic sites in mammalian cells (HEK239T). The genes VEGFA and FANCF were selected as targets for Cas12a and Cas9 and each target was tested with each Cas protein using corresponding fgRNA designs. Editing efficiency was analyzed with the T7 Endonuclease I (T7EI) assay widely used in the CRISPR field. Controls included the use of conventional crRNAs and sgRNAs with their cognate Cas effectors as positive controls, and non-targeting guides as negative controls. Desired spacer sequences were ordered as synthetic oligos, annealed, and cloned in via golden-gate assembly utilizing SapI as restriction enzyme.
| Table 1: A list of all the different spacers we cloned and tested within the fgRNA | |
| CCR5 | TGACATCAATTATTATACAT |
| Dnmt1 | GCTCAGCAGGCACCTGCCTC |
| Fancf | GGCGGGGTCCAGTTCCGGGA |
| Oct1 (BBa_K5237018) | ATGCAAATACTGCACTAGTG |
| Runx1 | CCTTCGGAGCGAAAACCAAG |
| TetO (BBa_K5237019) | TCTCTATCACTGATAGGGAG |
| VEGFA | CTAGGAATATTGAAGGGGGC |
| Table 2: A list of all the different linkers we cloned and tested within the fgRNA design | |
| 5 nt linker | ATGCG |
| 10 nt linker | ATGCGAGCTG |
| 10 nt Poly A linker | CAAAACAACA |
| 20 nt linker | TGGCGGCGTGCTGACCGCTA |
| 20 nt Poly A linker | CAAAACAACAATCAAAACAA |
| 30 nt Poly A linker |
CAAAACAACAATCAAAACAA ATCAAAACAA |
| 40 nt Poly A linker |
CAAAACAACAATCAAAACAACAAAACAA CAATCAAAACAA |
We constructed a second entry vector incorporating an AsCas12a scaffold (5' taatttctactcttgtagat 3') instead of MbCas12a. The sequence of the AsCas12a scaffold was the only modification present in the resulting composite part. This vector was tested on the VEGFA and FANCF loci to assess functionality of the encoded fgRNA.
4. Results
In the following section, we provide a detailed quantitative characterization of part K5237000, tested under various experimental conditions and use cases.4.1 Editing endogenous loci with fgRNAs
To show that our fusion gRNA design results in an active CRISPR-Cas ribonucleoprotein complex, a series of different fgRNAs
were
cloned, each carrying spacer sequences specific to the VEGFA and FANCF target genes. HEK293T cells were then co-transfected
with the
Cas
protein and (f)gRNA encoding constructs. The editing rate was tested 72h after transfection via a T7 endonuclease I
assay.
Here, AsCas12a and SpCas9 were used. The AsCas12a spacer, in this case, targets VEGFA, while the SpCas9 spacer targets FANCF.
Samples included either (i) conventional single gRNAs co-expressed with the corresponding Cas proteins (positive controls), (ii) the fgRNA co-expressed with only one of
the two
Cas
proteins (as control for Cas ortholog dependency) and (iii) the fgRNA with both Cas proteins simultaneously co-expressed (Fig. 5). The conventional sgRNAs resulted in
potent editing ("editing" refers to the observed indel frequency) for both target genes (45% for VEGFA and 15% for FANCF). Note that editing rates for
FANCF
were
consistently lower in all experiments, which likely is due to the specific properties of the FANCF-targeted locus. Importantly, as hoped, targeting FANCF with fgRNAs resulted in noticeable
editing
of
about 10%, when we added the SpCas9 alone or both Cas proteins into the sample. For VEGFA, the AsCas12a only sample
resulted
in approximately 20% editing in combination with the fgRNA, while adding both Cas proteins led to
approximately 40%. These initial results confirmed that our fgRNA design indeed functions, enabling simultaneous recuitment of two different Cas proteins to separate loci in human cells.
4.2 Efficient Fusion Guide RNA-Mediated Editing With Various Cas Orthologs
After showing efficient editing, the next step was to evaluate the capabilities of the fgRNAs. To this end, we tested fgRNAs in combination with different Cas12a orthologs. Following some initial testing, we decided to use MbCas12a together with SpCas9 in subsequent experiments, since MbCas12a turned out to be more effective than AsCas12a in a dual luciferase assay when co-transfected with SpCas9 (Fig. 6). Of note, SpCas9 reproducibly showed high potency.
Additionally, to test if the differences in editing rates from the preliminary assay resulted from the
targeted
loci or the different Cas orthologs, the spacers were tested in both arrangements. Once with Cas12a
targeting
FANCF and SpCas9 targeting VEGFA and once vice versa. To better assess the impact that the utilization
of a
fgRNA
has on the editing rates, the sgRNAs were tested separately and in one sample.
Having the sgRNA with single Cas
proteins in the same sample resulted in no clear difference in the editing rates (Fig. 7). The fusion of
the
gRNAs resulted in a lower editing rate overall. While the editing for VEGFA
stayed at about 20% in all cases, the editing for FANCF dropped significantly. When targeting the same
gene
under
the same conditions, the editing rates for MbCas12a were overall lower than the ones from SpCas9.
4.3 The Inclusion of a Linker Does Not Lower Editing Rates
To further assess the effect of the genomic locus on the editing rate, we included CCR5 as an additional gene target. For this assay, a fgRNA with a 20 nt long linker was included between the two spacers. The editing rate for VEGFA was again relatively consistent throughout the samples (Fig. 8). For CCR5, the editing rate with sgRNAs was approximately the same at about 30%. However, it dropped below 10% for the fgRNA. The addition of the 20 nt linker had no effect on the editing rates compared to no linker.
4.4 Fusion Guide RNAs can be Used for CRISPRa
To establish the foundation for their use as protein scaffolds, we identified the next step as demonstrating the use of fgRNAs for CRISPRa. For this, we intend to recruit the transcriptional activator VP64 to a firefly luciferase gene to induce expression. The VP64 protein is attached to the catalytically inactive Cas9 protein, which is then guided by gRNAs to the luciferase gene. The gRNAs target a TetO sequence, which is positioned in front of the luciferase gene in multiple repeats. The firefly luciferase activity was then quantified as photon counts and normalized against Renilla luciferase, which is expressed on a separate plasmid under an ubiquitous promoter. In two biological replicates we saw similar relative luciferase activity with fgRNA as a guide compared to a sgRNA (Fig. 9).
4.5 Stapling Two DNA Strands Together Using fgRNAs
After showing the general capability of the fgRNA
to work for editing and for CRISPR activation, the next step was to use it to staple two DNA loci
together, and
thereby induce proximity between two separate functional elements. For this, an enhancer plasmid and a
reporter
plasmid was used. The reporter plasmid has firefly luciferase behind several repeats of a Cas9 targeted
sequence.
The enhancer plasmid has a Gal4 binding site behind several repeats of a Cas12a targeted sequence. By
introducing
a fgRNA staple and a Gal4-VP64, expression of the luciferase is induced (Fig. 10, Panel A).
Different linker lengths were tested. Cells were again normalized against ubiquitous renilla
expression.
Using no linker between the two spacers showed similar relative luciferase activity to the baseline
control
(Fig. 10, Panel B). An extension of the linker from 20 nt up to 40 nt resulted in an increasingly higher
expression of the
reporter gene. These results suggest an extension of the linker might lead to better transactivation
when
hijacking an enhancer/activator.
5. References
Aregger, M., Xing, K., & Gonatopoulos-Pournatzis, T. (2021). Application of CHyMErA Cas9-Cas12a combinatorial genome-editing platform for genetic interaction mapping and gene fragment deletion screening. Nature Protocols, 16, 4722-4765. https://doi.org/10.1038/s41596-021-00595-1
Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819-823. https://doi.org/10.1126/science.1231143
Gonatopoulos-Pournatzis, T., Aregger, M., Brown, K. R., Farhangmehr, S., Braunschweig, U., Ward, H. N., Ha, K. C. H., Weiss, A., Billmann, M., Durbic, T., Myers, C. L., Blencowe, B. J., & Moffat, J. (2020). Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Nature Biotechnology, 38, 638-648. https://doi.org/10.1038/s41587-020-0437-z
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816-821. https://doi.org/10.1126/science.1225829
Kampmann, M. (2017). CRISPRi and CRISPRa screens in mammalian cells for precision biology and medicine. ACS Chemical Biology, 13, 406-416. https://doi.org/10.1021/acschembio.7b00657
Kleinstiver, B. P., Sousa, A. A., Walton, R. T., Tak, Y. E., Hsu, J. Y., Clement, K., Welch, M. M., Horng, J. E., Malagon-Lopez, J., Scarfò, I., Maus, M. V., Pinello, L., Aryee, M. J., & Joung, J. K. (2019). Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nature Biotechnology, 37, 276-282. https://doi.org/10.1038/s41587-018-0011-0
Koonin, E. V., Gootenberg, J. S., & Abudayyeh, O. O. (2023). Discovery of diverse CRISPR-Cas systems and expansion of the genome engineering toolbox. Biochemistry, 62, 3465-3487. https://doi.org/10.1021/acs.biochem.3c00159
Kweon, J., Jang, A.-H., Kim, D.-e., Yang, J. W., Yoon, M., Rim Shin, H., Kim, J.-S., & Kim, Y. (2017). Fusion guide RNAs for orthogonal gene manipulation with Cas9 and Cpf1. Nature Communications, 8. https://doi.org/10.1038/s41467-017-01650-w
Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-guided human genome engineering via Cas9. Science, 339, 823-826. https://doi.org/10.1126/science.1232033
Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., & Nureki, O. (2014). Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell, 156, 935-949. https://doi.org/10.1016/j.cell.2014.02.001
Pacesa, M., Pelea, O., & Jinek, M. (2024). Past, present, and future of CRISPR genome editing technologies. Cell, 187, 1076-1100. https://doi.org/10.1016/j.cell.2024.01.042
Paul, B., & Montoya, G. (2020). CRISPR-Cas12a: Functional overview and applications. Biomedical Journal, 43, 8-17. https://doi.org/10.1016/j.bj.2019.10.005
Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature, 507, 62-67. https://doi.org/10.1038/nature13011
Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., van der Oost, J., Regev, A., Koonin, E. V., & Zhang, F. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 163, 759-771. https://doi.org/10.1016/j.cell.2015.09.038
| None |