Coding

Part:BBa_K4221004

Designed by: Chenzhang Ma   Group: iGEM22_BJEA_China   (2022-09-27)
Revision as of 08:06, 11 October 2022 by Chenzhang (Talk | contribs) (Aqueous two-phase separation (ATPS) Testing)


mOrange

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 43
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 1000
    COMPATIBLE WITH RFC[1000]



Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mOrange[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

Biology

Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]

Design Consideration

The construct was cloned into a PET28a plasmid and transformed into mOrange-PET28a [2]

The construction includes:

mOrange is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT) and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT)

Protein Expression

We transformed recombinant plasmids (pET28a-mOrange-GSlinker-BslA) into BL21 and Rosetta expressing strains.

Figure-6 a .png
Figure-6 b .png

Figure 1.(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,

Figure-7 a .png
Figure-7 b .png

Figure 2.(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,

Detection of fusion protein function

After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant (use 1×PBS as buffer). In order to verify that the fusion protein (mOrange-GSlinker-BslA) was successfully fused and expressed compared to the control group (mOrange). We attempted to conduct water contact angle experiments. Due to experimental conditions, we cannot use professional instruments. We used parafilm as the substrate, which is an extremely hydrophobic interface, and added droplets of the supernatant of the control group and the supernatant of the fusion protein experimental group respectively for observation. We found that the contact angle of the control group was much smaller than that of the experimental group. This means that the supernatant of the control group was hydrophobic as a whole, while the experimental group was hydrophilic. BslA, as a hydrophobin, has the characteristic of reversing surface properties. Through this experiment, we can prove the existence of BslA in the experimental group.

Figure-8 a .png
Figure 3.Water contact angle.

Aqueous two-phase separation (ATPS) Testing

Then, we used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated. We found that the fluorescence color was still in the lower layer (aqueous phase) in both the experimental group and the control group.

In theory, fluorescence should appear in the upper layer (organic phase) because When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our experiments did not get perfect results, we analyzed some possible reasons and tried to continue experiments to explore in the future.

First, the current system is still small. Although we can see the fluorescence color, it is very shallow, and even though there may be some fluorescence in the organic phase, it is not visible to the naked eye due to the small amount. Therefore, we need to expand the system of protein-induced expression in the future.

Second, this may be related to the choice of buffer. We used 1xPBS to dissolve the supernatant obtained after sonication, and it may be possible to change the buffer of other pH to have different results.

Third, it may be related to the hydrophilicity and hydrophobicity of the supernatant. The supernatant contains all proteins expressed by the cells, including the target protein. Through the water contact angle experiment, we can find that the supernatant of the control group is hydrophobic as a whole, which may be caused by the hydrophobicity of some endogenous proteins in cells. Their presence may affect the function of BslA in the ATPS system.


Based on a review published at 2016 (Iqbal,M. et al.), we assumed that other potential rationales that contribute unsuccessful partitioning of protein in ATPS might be unsuitable concentration of salt aqueous solution, unsuitable temperature and incorrect selection of solute in organic phase. Extremely high concentration of salts may alter the hydrophobicity of biomolecules. As a consequence of the hydrophobic ions force the partitioning of counter ions to phase with higher hydrophobicity and vice versa. Thereafter, the addition of salts has critical influence on the partitioning coefficient based on following equation. The temperature can alter the coefficient as well. Moreover, it can generate effect on partitioning through the through viscosity and density.

Figure-9 b .png
Figure 4. ATPS testing.

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.


[edit]
Categories
Parameters
None