Part:BBa_K4221004
mOrange
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 43
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 43
Illegal SpeI site found at 619 - 1000COMPATIBLE WITH RFC[1000]
Usage
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mOrange[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
Biology
Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]
Design Consideration
The construct was cloned into a PET28a plasmid and transformed into mOrange-PET28a [2]
The construction includes:
mOrange is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT) and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT)
Protein Expression
Figure 1.(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,
Figure 2.(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,
Detection of fusion protein function
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant, We used a comparative experiment to add different droplets to the hydrophobic material and observe the water contact Angle.
Aqueous two-phase separation (ATPS) Testing
We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.
Reference
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.
None |